Frankenia capitata — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Frankeniaceae/Frankenia

At a glance

Occurrence records263

Data sources5

Biological traits19

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Frankenia capitata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Occurrence & distributionGBIF263 records

DNA & barcodingNCBIsequences

01Narrative

Frankenia capitata is a species of flowering plant in the family Fabaceae, native to southern Macaronesia (the Canary Islands, Madeira and the Salvage Islands).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology4

Leaf length max5 mm

Leaf length min2 mm

Plant height max0.3 m

Plant height min0.1 m

Life cycle & reproduction7

Flower colourpink

Flower length max6 mm

Flower length min4 mm

Flowering endNov

Flowering startFeb

Life formsubshrub

Life spanperennial

Habitat & environment6

Climatesubtropical

Elevation max100 m

Elevation min0 m

Growth formshrub

Leaf formlinear

Woodinesswoody

Other traits2

Leaf arrangementwhorled

Shoot orientationerect

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Frankenia capitata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR183458.1 ↗651 bpSpain

ACGT

CATTGTCGAACCTGCACTCGCAGAACGACCAGCGAACATGTTGCATAACTACGGGGAGCGGGCATCTGCTCAAACCCCATTACACGAAGG …

Frankenia capitata isolate ABHsn internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type263 records

Wild obs. + sensor252

Museum / vouchered11

Range

Area of Occupancy AOO644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 98≤1 km 30≤10 km 80>10 km 5

213 georeferenced · 39 without coordinates

Open the mapobservation + sensor252

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	2
Vancouver, CA	1
Philadelphia, US	1
MeiseBGlocation not on record	1

5 institutions · 9 of 11 vouchered records shown · 2 without an institution code