Frangula rubra

(Greene) Grubov · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Frangula

At a glance

Occurrence records214

Data sources6

Biological traits13

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Frangula rubra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility214 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF214 records

DNA & barcodingNCBIsequences

01Narrative

Frangula rubra (syn. Rhamnus rubra) is a species of flowering plant in the buckthorn family known by the common names red buckthorn and Sierra coffeeberry. Frangula rubra branch

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass50.37 mg

Seed mass max50.37 mg

Seed mass min50.37 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Frangula rubra has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKR083287.1 ↗673 bp

ACGT

AGGAAGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCCTGCACAGCAGAACGACCCGCGAACTTG …

Frangula rubra voucher Sharsmith 4265 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type214 records

Wild obs. + sensor80

Museum / vouchered134

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 56≤1 km 4≤10 km 4

64 georeferenced · 16 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 6≤1 km 50≤10 km 35>10 km 4

95 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	29
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	24
Chicago, US	22
Arcata, US	14
CASlocation not on record	10
San Diego, US	6
Los Angeles, US	4
San Jose, US	3
STNFlocation not on record	2
Truckee, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
Saint Louis, US	2
Bloomington, US	2
Logan, US	1
Northridge, US	1
Tampa, US	1
INFlocation not on record	1
St. Paul, US	1
Canadian Department of Agriculturelocation not on record	1
Museum of the Rockieslocation not on record	1

20 institutions · 129 of 134 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)