Fragaria vesca
speciesAt a glance
Occurrence records704 729
Data sources15
Biological traits70
DNA specimens87
eDNA detections80
Sources15 archives
Databases and archives Fragaria vesca's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility704 729 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI80 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics87 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources70 traits
Chemical compositionLOTUS · NPASS137 compounds
Occurrence & distributionGBIF704 729 records
Environmental DNA5 datasets · 14 countries80 detections
DNA & barcodingBOLD · NCBI87 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex284 Mbp
01Narrative
Le fraisier des bois est une espèce de plantes herbacées vivaces de la famille des Rosaceae. Avec plusieurs sous-espèces, il se trouve dans tout l'hémisphère Nord, ce qui en fait le fraisier sauvage le plus répandu. Ses fruits rouges, ou parfois blancs, les fraises des bois, sont réputés pour leur arôme plus recherché que celui des fraises des jardins. Le fraisier des bois est appelé aussi populairement « fraisier commun » ou « fraisier sauvage ». C'est une espèce originaire d'Europe, d'Amérique du Nord et d'Asie tropicale et naturalisée en d'autres points du globe.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology25
Fruit length12.2 mm
Fruit length max17 mm
Fruit length min10 mm
Fruit width10.75 mm
Leaf length30 mm
Leaf length max50 mm
Leaf length min10 mm
Leaf mass133 mg
Leaf size450 mm²
⚠ sources differ — TRY: 450 mm² · LEDA: 2 394 mm² · GIFT: 2 394 mm²
Leaf width23 mm
Leaf width max40 mm
Leaf width min6 mm
Plant height0.141 m
⚠ sources differ — GIFT: 0.141 m · LEDA: 0.1 m · TRY: 0.106 m
Plant height generative0.11 m
Plant height max0.3 m
Plant height min0.05 m
Seed length1.29 mm
Seed length max1.3 mm
Seed length min1.3 mm
Seed mass0.335 mg
⚠ sources differ — TRY: 0.335 mg · LEDA: 0.319 mg · GIFT: 4.24 mg
Seed mass max0.53 mg
Seed mass min0.27 mg
Seed volume0.52 mm³
Seed volume max0.52 mm³
Seed volume min0.52 mm³
Life cycle & reproduction16
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourwhite
Flowering endJun
Flowering startMay
Life formperennial
Life spanperennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number324
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourred
Fruit fleshinessfleshy
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf formovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio27.58 g/g
Leaf c455 mg/g
Leaf dry-matter content (LDMC)289 mg/g
⚠ sources differ — TRY: 289 mg/g · LEDA: 388 mg/g
Leaf n17.89 mg/g
Leaf p4.2 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)26.29 mm²/mg
⚠ sources differ — TRY: 26.29 mm²/mg · LEDA: 19.7 mm²/mg · GIFT: 23.17 mm²/mg
Wood density270 mg/cm³
Other traits4
Diaspore typefruit
Leaf arrangementrosette
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition137 compounds
Compounds documented for Fragaria vesca across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Cinnamic acids and derivatives19
Flavones14
Menthane monoterpenoids $ Monocyclic monoterpenoids8
Acyclic monoterpenoids8
Menthane monoterpenoids8
Documented compounds137 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Menthol | present | NPASS | |
| (+)-Perillyl alcohol | present | NPASS | |
| (+)-Ursolic Acid | present | NPASS | |
| (-)-alpha-Pinene | present | NPASS | |
| (-)-Camphene | present | NPASS | |
| (-)-Caryophyllene | present | NPASS | |
| (-)-Linalool | present | NPASS | |
| (-)-Menthol | present | NPASS | |
| (2E)-1-(3-Furanyl)-4-methyl-2-penten-1-one | present | NPASS | |
| (2R)-3-(3,4-dihydroxyphenyl)-2-hydroxypropanamide | present | NPASS |
05DNA & barcoding87 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fragaria vesca has left across the world's sequence archives.
At a glance
DNA specimens87
Marker genes7
GenBank sequences10
eDNA detections80
Countries14
The DNA barcodea real sequence read deposited for this species
GTCGTTGCCCCCCCGACCCCTTCGGGGGCCGGACGGGACGGATGATGGCCTTCCCGTGTGCCCCGTCACGCGGTTGGCATAAATACCGAG …
Fragaria vesca isolate CL2021-2024 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL2★rbcLa★ITS6★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI
The complete instruction manual Fragaria vesca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size283 620 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Fragaria vesca0.28 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–562n range14median14mode118records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 14115×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database +21
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · brit-fl — Jones, J.K. (1955)
CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2648
CCDB · fl-europaea — Gadella &
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Rostovtseva, T. S., I. M. Krasnoborov & S. A. Krasnikova. 1981. Chisla khromosom nekotorych vidov flory Sibiri. Sb. Novye Dannye o Fitogeografii Sibiri. 215–220.
CCDB · ipcn-api-dl — Van Loon, J. C. & J. J. M. H. OUDEMANS. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 343–344.
CCDB · ipcn-api-dl — Lippert, W. 1985. Morphologische und zytologische Untersuchung an Fragaria insbesondere an Fragaria moschata) in Bayern. Bot. Jahrb. Syst. 107: 195–202.
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Niemirowicz-szczytt, K., B. Ciupka & S. Malepszy. 1984. Polyploids from Fragaria vesca L. meristems, induced by colchicine in the in vitro culture. Bull. Acad. Polon. Sci., Ser. Sci. Biol. 32: 57–63.
CCDB · ipcn-api-dl — Iwatsubo, Y. & N. Naruhashi. 1989. Karyotypes of three species of Fragaria (Rosaceae). Cytologia 54: 493–497.
CCDB · ipcn-api-dl — Semerenko, L. V. 1990. Chromosome numbers of some flowering plants from the Berezinsky Biosphere Reservation (the Byelorussian Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 279–282.
CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.
CCDB · ipcn-api-dl — Queirós, M. 1991. Números cromossómicos para a flora Portuguesa. 104--105. Bol. Soc. Brot., sér. 2 64: 135–142.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Ge, H. b., J. j. Lei & Z. h. Guo. 1997. A preliminary report on chromosome number and interspecific hybridization in Fragaria. J. Agric. Univ. Hebei 20(3): 56–60.
CCDB · ipcn-api-dl — Niemirowicz-szczytt, K. & S. Malepszy. 1980. Micropropagation from the meristems and young leaves of Fragaria. Bull. Acad. Polon. Sci., Ser. Sci. Biol. 28: 335–340.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Staudt, G. 1999. Systematics and geographic distribution of the American strawberry species. Taxonomic studies in the genus Fragaria (Rosaceae: Potentilleae). Univ. Calif. Publ. Bot. 81: 1–162.
CCDB · ipcn-api-dl — Schuster, M. 2003. In G. Staudt, L. M. DiMeglio, T. M. Davis & P. Gerstberger, Fragaria @xbifera Duch.: origin and taxonomy. Bot. Jahrb. Syst. 125(1): 53–72.
CCDB · book-ipcn66 — Bringhurst & S. 1966
CCDB · book-ipcn67-71 — GUPTA, B.K. 1970. Chromosome survey in strawberries of Kashmir. Cytologia 35: 107-110.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1967. Chromosome numbers of flowering plants in the Netherlands III. Proc. Roy. Neth. Acad. Sci. Ser. c. 70: 7-20.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn75-78 — Murin 1974
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · book-ipcn75-78 — Kartashova et al. 1974
CCDB · book-northern-plants — Turesson 1938.
CCDB · book-ipcn73-74 — EVANS, w.o. 1974. Evidence of a crossability barrier in diploid X hexaploid and diploid X octoploid crosses in the genus Fragaria. Euphytica 23: 95-100.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-indian_vol1 — Ichijima, K. 1926, 1930; Longley, A.E. 1926 ; Yarnell, S.H. 1929a,b, 1931a ; Rudloff, C. F. 1930 ; Fedorova, N.J. (Fedorov); Tischler, G~ 1934; Darrow, G.M. 1937; Rohweder, H. 1937 ; Tures- son, G. 1938; Dogadkina, N.A. (Fedo- rov); Delay, C. 1947; Love, A. & Love, D. 1956b ; Skalinska, M. et al. 1959; Staudt, G. 1962; Gadella, T.W.J. & Kliphuis, E. 1967; Zhukova, P.G. 1967b; Gupta, B.K. 1970a
+61 more references
2n 352×CCDB · book-indian_vol1 · CCDB · Cave1963
CCDB · book-indian_vol1 — Bringhurst, R.S. & Khan, D.A. 1963
CCDB · Cave1963 — Bring, & Khan 1963
2n 562×CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · book-indian_vol1 — Mehra, P .N. & Dhawan, H. 1966a
CCDB · CromoCat 2015 — Gabrielan, E. & Zohary, D. (2004). Wild relatives of food crops native to Armenian and Nakhichevan Fl. Medit. 14: 5-80
2n 281×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Sebastiampillai, A.R. & Jones, J.K. 1977
n 71×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gupta, P. K. (1970). Chromosome survey in strawberries of Kashmir. Cytologia 35: 107-110.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.2% BUSCO
08Occurrence & distribution
Record type704 729 records
Wild obs. + sensor673 949
Museum / vouchered23 409
Cultivated / captive491
Fossil7
Other6 873
Origin
Native28 540
Introduced83
Range
Area of Occupancy AOO733 432 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 159 833≤1 km 110 926≤10 km 278 630>10 km 5 218
554 607 georeferenced · 119 342 without coordinates
Open the mapobservation + sensor673 949
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy36% within 1 km
≤100 m 1 670≤1 km 4 786≤10 km 10 468>10 km 1 108
18 032 georeferenced · 5 377 without coordinates
Open the institutions mapphysical evidence23 409
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤100 m 2≤1 km 1≤10 km 30>10 km 13
46 georeferenced · 445 without coordinates
Open the mapnot free-living491
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions224 of 402 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 11 492 |
| Helsinki, FI | 785 |
| BFLlocation not on record | 676 |
| Olocation not on record | 515 |
| LDlocation not on record | 503 |
| Salzburg, AT | 360 |
| Moscow State Universitylocation not on record | 356 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 277 |
| Oulu, FI | 273 |
| DBF-NHMDlocation not on record | 271 |
| Oskarshamn, SE | 222 |
| MeiseBGlocation not on record | 212 |
| Philadelphia, US | 193 |
| Jyväskylä, FI | 181 |
| Trondheim, NO | 168 |
| SLU Artdatabankenlocation not on record | 163 |
| Turku, FI | 142 |
| Garðabær, IS | 136 |
| Berlin, DE | 127 |
| Beijing, CN | 126 |
| Bergen, NO | 123 |
| TROMlocation not on record | 122 |
| KMNlocation not on record | 120 |
| Kuopio, FI | 109 |
| Adam Mickiewicz University in Poznańlocation not on record | 106 |
| Moscow, US | 92 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 75 |
| Provincia di Livornolocation not on record | 71 |
| Tartu, EE | 70 |
| Arcata, US | 69 |
| Voronezh State Universitylocation not on record | 68 |
| Uniwersytet Warszawskilocation not on record | 68 |
| Tallinn, EE | 62 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 62 |
| Barcelona, ES | 60 |
| Santa Cruz, US | 59 |
| Chongqing Museumlocation not on record | 58 |
| BDBClocation not on record | 57 |
| BRNUlocation not on record | 57 |
| Yangling, CN | 57 |
| Victoria, CA | 55 |
| MAlocation not on record | 49 |
| New Haven, US | 48 |
| Missoula, US | 47 |
| San Diego, US | 44 |
| University of New Hampshirelocation not on record | 41 |
| València, ES | 40 |
| Görlitz, DE | 39 |
| Porvoo, FI | 38 |
| Denver, US | 38 |
| Saint Louis, US | 38 |
| Uppsala, SE | 37 |
| TUR-Alocation not on record | 36 |
| Ann Arbor, US | 36 |
| Santa Barbara, US | 35 |
| BClocation not on record | 34 |
| Urumqi, CN | 33 |
| Pullman, US | 33 |
| Entomological Society of Latvialocation not on record | 33 |
| Bern, CH | 33 |
| South Kensington, GB | 31 |
| San Sebastián, ES | 31 |
| GJOlocation not on record | 31 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 31 |
| 31 | |
| Bronx, US | 31 |
| Vitoria, ES | 30 |
| Riverside, US | 29 |
| WTUlocation not on record | 29 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 29 |
| Wlocation not on record | 28 |
| Claremont, US | 26 |
| Durango, MX | 26 |
| Vancouver, CA | 26 |
| Mlocation not on record | 25 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 25 |
| Green Bay, US | 25 |
| Toronto, CA | 24 |
| Chengdu, CN | 24 |
| San Luis Obispo, US | 24 |
| Boise, US | 22 |
| Portland, US | 21 |
| Philadelphia, US | 21 |
| Davis, US | 21 |
| Albuquerque, US | 20 |
| Spearfish, US | 20 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 20 |
| Québec, CA | 19 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 19 |
| Pocatello, US | 19 |
| GZUlocation not on record | 19 |
| CICYTEXlocation not on record | 18 |
| Zürich, CH | 17 |
| Saint John, CA | 17 |
| University of Alberta Museumslocation not on record | 16 |
| Durango, US | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 16 |
| Frankfurt am Main | 16 |
| Stockholm, SE | 16 |
| Guangzhou, CN | 16 |
| Universidad de Caldas (UCaldas)location not on record | 16 |
| SWlocation not on record | 16 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 15 |
| Rovaniemi, FI | 15 |
| Madison, US | 15 |
| CJBGlocation not on record | 15 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| Uniwersytet Jagiellońskilocation not on record | 15 |
| ISAlocation not on record | 15 |
| Kandalaksha State Nature Reservelocation not on record | 14 |
| US | 13 |
| Chadron, US | 13 |
| Austin, US | 13 |
| Aarhus, DK | 13 |
| Uniwersytet Opolskilocation not on record | 13 |
| Chengdu, CN | 12 |
| Acadia Universitylocation not on record | 12 |
| Tampa, US | 12 |
| Canberra, AU | 12 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 12 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 12 |
| Tula State Universitylocation not on record | 12 |
| DOI/NPS, Greenbelt Parklocation not on record | 12 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 12 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 12 |
| Madrid, ES | 11 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 11 |
| Xiamen, CN | 11 |
| Porrentruy, CH | 11 |
| Dresden, DE | 11 |
| WNNUlocation not on record | 11 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| Provo, US | 10 |
| College of the Atlantic, Museumlocation not on record | 9 |
| St. Paul, US | 9 |
| Baroda, IN | 9 |
| Salamanca, ES | 9 |
| Logan, US | 8 |
| nbflocation not on record | 8 |
| Millersville, US | 8 |
| Xining, CN | 8 |
| Durham, US | 8 |
| USFS/BHSClocation not on record | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Burlington, US | 8 |
| Rotorua, NZ | 8 |
| Cheney, US | 8 |
| KIRMlocation not on record | 8 |
| Fulda, DE | 8 |
| Caldwell, US | 8 |
| Universidad de La Salle (La Salle)location not on record | 8 |
| Quito, EC | 8 |
| Kunming, CN | 8 |
| Cambridge, US | 7 |
| Universidad Nacional de Colombia (UNAL)location not on record | 7 |
| Tuxtla Gutiérrez, MX | 7 |
| PRClocation not on record | 7 |
| Flagstaff, US | 7 |
| Kew, GB | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| Dekalb, US | 7 |
| Badajoz, ES | 7 |
| Davenport, US | 7 |
| Mexico City, MX | 7 |
| Winterthur, CH | 7 |
| Urumqi, CN | 7 |
| Corvallis, US | 7 |
| Podgorica, ME | 6 |
| University of Stellenboschlocation not on record | 6 |
| Severin-McDaniel Insect Collectionlocation not on record | 6 |
| Pamplona, ES | 6 |
| Pretoria, ZA | 6 |
| Universidad de Nariño (UdeNar)location not on record | 6 |
| Loja, EC | 6 |
| Forssa, FI | 6 |
| EL PASO, US | 6 |
| Université Lavallocation not on record | 6 |
| SZUlocation not on record | 5 |
| Nagano City, JP | 5 |
| Wellington, NZ | 5 |
| CASlocation not on record | 5 |
| Bloomington, US | 5 |
| Whitewater, US | 5 |
| Bourges, FR | 5 |
| Pittsburg, US | 5 |
| San Jose, US | 5 |
| Tapachula, MX | 5 |
| PrivatHerblocation not on record | 5 |
| Weber State Universitylocation not on record | 5 |
| UTPLlocation not on record | 5 |
| Nanchong, CN | 5 |
| Hobart, AU | 5 |
| Bend, US | 5 |
| 东北师范大学自然博物馆location not on record | 5 |
| Ivano-Frankove, UA | 5 |
| Cambridge, US | 4 |
| Alicante, ES | 4 |
| Bangkok, TH | 4 |
| Lincoln, US | 4 |
| Philadelphia, US | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Bozeman, US | 4 |
| Northridge, US | 4 |
| Zürich, CH | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Auckland, NZ | 4 |
| Austin, US | 4 |
| UGentlocation not on record | 4 |
| Staten Island, US | 4 |
| Herb. BBGlocation not on record | 4 |
| Otaru, JP | 4 |
| Ashland, US | 4 |
| Montréal, CA | 4 |
| Tacoma, US | 4 |
| Whitehorse, CA | 4 |
| Tilburg, NL | 3 |
| Brookings, US | 3 |
| Glarus, CH | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Salvador, BR | 3 |
| BSBIlocation not on record | 3 |
| New Brunswick, US | 3 |
| FLADlocation not on record | 3 |
| Cuenca, EC | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Lausanne, CH | 3 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 3 |
| Iwate Prefectural Museumlocation not on record | 3 |
| Keene State Universitylocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| HJAEFlocation not on record | 3 |
| University of British Columbia, Herbariumlocation not on record | 3 |
| UoB-IBlocation not on record | 3 |
| Honolulu, US | 3 |
| Karlsruhe, DE | 3 |
| QCNElocation not on record | 3 |
| Puerto Ayora, EC | 3 |
| Sion, CH | 3 |
| BISHlocation not on record | 3 |
| ASUlocation not on record | 3 |
| GB | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Christchurch, NZ | 3 |
| Altos de Pipe, VE | 2 |
| Taipei, TW | 2 |
| Chiba, JP | 2 |
| Ivano-Frankivsk, UA | 2 |
| Bando, JP | 2 |
| Oswego, US | 2 |
| Göteborg, SE | 2 |
| BG-NMNHSlocation not on record | 2 |
| Henderson, US | 2 |
| LNBG$location not on record | 2 |
| Kushiro City Museumlocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Riobamba, EC | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Morgantown, US | 2 |
| WINlocation not on record | 2 |
| Macomb, US | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Nanjing, CN | 2 |
| Turlock, US | 2 |
| Ciudad de México, MX | 2 |
| Los Angeles, US | 2 |
| San Angelo, US | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| OLAlocation not on record | 2 |
| LfUlocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| SXTCMlocation not on record | 2 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Santiago de Compostela, ES | 2 |
| Banyoles, ES | 2 |
| Columbia, US | 2 |
| National Botanic Garden of Waleslocation not on record | 2 |
| Blumenau, BR | 2 |
| Taipei, TW | 2 |
| San Francisco, US | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Chicago, US | 2 |
| Wuzhou, CN | 2 |
| National Museum Waleslocation not on record | 2 |
| Dehra Dun, IN | 2 |
| JBRJlocation not on record | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Siouxland Heritage Museumlocation not on record | 2 |
| Mississippi State, US | 2 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| Clemson, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Smithsonian Institutionlocation not on record | 1 |
| Granada, ES | 1 |
| INMAlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Nijmegen, NL | 1 |
| H-Wolflocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Edinburgh, GB | 1 |
| CJBNlocation not on record | 1 |
| Smithfield, AU | 1 |
| Tempe, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Williamsburg, US | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Fort Worth, US | 1 |
| Norfolk, US | 1 |
| ROM020location not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Wuhan, CN | 1 |
| IEBlocation not on record | 1 |
| UFSClocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Chapel Hill, US | 1 |
| Guilin, CN | 1 |
| Miami, US | 1 |
| Walla Walla, US | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| UERJlocation not on record | 1 |
| UFPIlocation not on record | 1 |
| Criciúma, BR | 1 |
| IPE-CSIClocation not on record | 1 |
| Plocation not on record | 1 |
| H-Dueringlocation not on record | 1 |
| UFABClocation not on record | 1 |
| Phoenix, US | 1 |
| Stockholm, SE | 1 |
| KNFYlocation not on record | 1 |
| AUT001location not on record | 1 |
| ESP198location not on record | 1 |
| HAWlocation not on record | 1 |
| München, DE | 1 |
| San Isidro, AR | 1 |
| Frauenfeld, CH | 1 |
| Armidale, AU | 1 |
| Kensington, AU | 1 |
| Mérida, MX | 1 |
| IDElocation not on record | 1 |
| Corrientes, AR | 1 |
| Yunnan Universitylocation not on record | 1 |
| Dhaka, BD | 1 |
| Columbus State Universitylocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| Tampere, FI | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Brisbane, AU | 1 |
| KNFHClocation not on record | 1 |
| Nishihara, JP | 1 |
| Portland, US | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Xian, CN | 1 |
| Pomona Collegelocation not on record | 1 |
| Mount Annan, AU | 1 |
| UFOPlocation not on record | 1 |
| La Paz, BO | 1 |
| Hudson, US | 1 |
| Sevilla, ES | 1 |
| University of Lethbridgelocation not on record | 1 |
| Adelaide, AU | 1 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 1 |
| Department of Botany, GC University, Lahorelocation not on record | 1 |
| Paris, FR | 1 |
| NMBU:MINAlocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| UIBlocation not on record | 1 |
| STNFlocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Chicago, US | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Kingston, US | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Decorah, US | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Tsukuba, JP | 1 |
| US | 1 |
| College Park, US | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| UNESClocation not on record | 1 |
| Angwin, US | 1 |
| Odawara, JP | 1 |
| Tomioka, JP | 1 |
402 institutions · 21 667 of 23 409 vouchered records shown · 1 387 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA80 detections
Where the DNA of Fragaria vesca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found80
Studies independent surveys5
Countries14
Verifiable raw sequence linked12
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 80 detections have coordinates
Open the map14 countries0
Disturbed meadow in townsite.damp opening on eastern edge of meadow with …Grassland hillsideSilty mud on slumping creek.in woodland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
pH5.40 4.80–8.27
Conductivity76.0 µS/cm 32.0–105
Organic carbon2.75 % 1.60–4.50
Water content14.9 % 8.45–21.6
Nitrate-N3.50 mg/kg 2.00–21.0
Nitrate0.298 µmol/L 0.132–0.465
Phosphorus45.0 mg/kg 14.0–113
Clay25.4 % 13.4–64.9
Sand60.2 % 24.9–76.5
Depth0.1 m 0–2.00
Coastal waterSoilPelagicSodosolKandosol
7 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C 6.80–18.4
Seasonal swing summer↔winter15.4 °C
Max temp (day)17.2 °C 8.20–23.4
Min temp (night)10.4 °C 3.20–16.1
Precipitation75.2 mm/mo 51.8–114
Air humidity62.1 % 55.8–65.4
Moisture balance-17.4 mm/mo -65.6–166
Vapour deficit602 Pa 358–883
Wind speed3.80 m/s 2.40–5.80
Cloud cover42.3 % 28.3–53.7
CHELSA 1981–2010, ~9 km grid, at location & month of 62 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.