Fragaria pentaphylla

Losinsk. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Fragaria

At a glance

Occurrence records165

Data sources12

Biological traits23

DNA specimens5

eDNA detections2

Sources12 archives

Databases and archives Fragaria pentaphylla's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility165 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF165 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 14

01Narrative

Fragaria pentaphylla is a tetraploid species of wild strawberry native to China. In Chinese, it is called the "five-leaf strawberry" ().

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Leaf length25 mm

Leaf length max40 mm

Leaf length min10 mm

Leaf size138 mm²

Leaf width18 mm

Leaf width max30 mm

Leaf width min6 mm

Plant height0.125 m

⚠ sources differ — GIFT: 0.125 m · TRY: 0.15 m

Plant height max0.15 m

Plant height min0.1 m

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max2 300 m

Elevation mean1 650 m

Elevation min1 000 m

Growth formherb

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)480 mg/g

Leaf n10.65 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)14.76 mm²/mg

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fragaria pentaphylla has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF163500.1 ↗676 bp

ACGT

GGAAGGATCATTGTCGAAACCTGCATGGCAGAACGACCCGAGAACACGTTCCGACGCTCGGGGGCGGGGGGTCTCGCGGCTCCTCGCCCC …

Fragaria pentaphylla clone 2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL8★ITS2

animal barcodeplant barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_065223 ↗ · 30 protein · 19 tRNA · 3 rRNA

nad1nad4cox1ccmFnnad2ccmFcrps3cox2rps4nad6atp1matRrps7rps1nad3nad4Latp4nad7atp8cox3sdh4cobatp6ccmCccmBatp9+7

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Fragaria pentaphylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · eflora +1

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Ge, H. b., J. j. Lei & Z. h. Guo. 1997. A preliminary report on chromosome number and interspecific hybridization in Fragaria. J. Agric. Univ. Hebei 20(3): 56–60.

CCDB · ipcn-api-dl — Schuster, M. 2001. In G. Staudt & W. B. Dickoré, Notes on Asiatic Fragaria species: Fragaria pentaphylla Losinsk. and Fragaria tibetica spec. nov. Bot. Jahrb. Syst. 123(3): 341–354.

CCDB · eflora

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type165 records

Wild obs. + sensor1

Museum / vouchered158

Other6

Origin

Native6

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence158

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yangling, CN	54
Chengdu, CN	33
Beijing, CN	17
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	12
CASlocation not on record	9
Guangzhou, CN	7
Chengdu, CN	6
WNNUlocation not on record	5
GMBAlocation not on record	3
Taipei, TW	3
Siouxland Heritage Museumlocation not on record	2
Xining, CN	2
Lanzhou, CN	1
Chengdu, CN	1
Fort Worth, US	1
Edinburgh, GB	1
Zhengzhou, CN	1

17 institutions · 158 of 158 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Fragaria pentaphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)