Fragaria nubicola

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Fragaria

At a glance

Occurrence records262

Data sources12

Biological traits24

DNA specimens4

eDNA detections40

Sources12 archives

Databases and archives Fragaria nubicola's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF262 records

Environmental DNA2 datasets · 3 countries40 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex≈204 Mbp

01Narrative

Fragaria nubicola is a species of wild strawberry native to the Himalayas. It is of no commercial value.G.M. Darrow, The Strawberry: History, Breeding and Physiology. Online version, chapter 8. All strawberries have a base haploid count of 7 chromosomes. Fragaria nubicola is diploid, having 2 pairs of these chromosomes for a total of 14 chromosomes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf length35 mm

Leaf length max60 mm

Leaf length min10 mm

Leaf width17.5 mm

Leaf width max30 mm

Leaf width min5 mm

Plant height0.15 m

Plant height max0.26 m

Plant height min0.04 m

Life cycle & reproduction5

Flowering endJun

Flowering startApr

Life formperennial

Life spanperennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max4 000 m

Elevation mean3 200 m

Elevation min1 400 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fragaria nubicola has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections40

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV485351.1 ↗735 bpIndia · 2016

ACGT

AGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATGGCAGAACGACCCGAGAACACGTTCCGAC …

Fragaria nubicola voucher ABANERJEE74999c small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL6★ITS4

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI

The complete instruction manual Fragaria nubicola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈203 686 407 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Fragaria nubicola0.20 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 148×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +4

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Iwatsubo, Y. & N. Naruhashi. 1991. Karyotypes of Fragaria nubicola and F. daltoniana (Rosaceae). Cytologia 56: 453–457.

CCDB · ipcn-api-dl — Staudt. 2006. Himalayan species of Fragaria (Rosaceae). Bot. Jahrb. Syst. 126(4): 483–508.

CCDB · book-ipcn66 — Kurosawa 1966

CCDB · book-ipcn73-74 — EVANS, w.o. 1974. Evidence of a crossability barrier in diploid X hexaploid and diploid X octoploid crosses in the genus Fragaria. Euphytica 23: 95-100.

CCDB · book-indian_vol1 — Kurosawa, S. 1966

CCDB · eflora

TreeOfSex · plant — Goldblatt1979 ↗

n 71×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 13

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness37% BUSCO

08Occurrence & distribution

Record type262 records

Wild obs. + sensor126

Museum / vouchered107

Cultivated / captive9

Other20

Origin

Native2

Introduced1

Range

Area of Occupancy AOO696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 42≤1 km 15≤10 km 15>10 km 2

74 georeferenced · 52 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence107

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 8 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	43
Herbarium of the Department of Botany, University of Tokyolocation not on record	38
University of Stellenboschlocation not on record	6
Kunming, CN	4
Xining, CN	4
Kathmandu, NP	2
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	2
Saint Louis, US	2
QAUlocation not on record	1
Logan, US	1
Beijing Normal Universitylocation not on record	1
Moscow State Universitylocation not on record	1
Elocation not on record	1
LDlocation not on record	1

14 institutions · 107 of 107 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA40 detections

Where the DNA of Fragaria nubicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 10.1–16.8

Seasonal swing summer↔winter23.3 °C

Max temp (day)18.0 °C 13.5–19.8

Min temp (night)11.7 °C 7.60–14.2

Precipitation73.9 mm/mo 56.8–94.5

Air humidity61.9 % 61.4–64.6

Moisture balance3.70 mm/mo -7.10–27.4

Vapour deficit643 Pa 438–740

Wind speed2.60 m/s 2.30–4.50

Cloud cover43.7 % 41.9–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)