Fragaria daltoniana

Gay · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Fragaria

At a glance

Occurrence records59

Data sources12

Biological traits26

DNA specimens4

eDNA detections3

Sources12 archives

Databases and archives Fragaria daltoniana's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF59 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 14

01Narrative

Fragaria daltoniana is a species of strawberry native to the Himalayas. Its fruit has a poor flavor, and is of no commercial value.G.M. Darrow, The Strawberry: History, Breeding and Physiology. Online version, chapter 8.Photo of F. daltoniana All strawberries have a base haploid count of 7 chromosomes. Fragaria daltoniana is diploid, having 2 pairs of these chromosomes for a total of 14 chromosomes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length16 mm

Fruit length max25 mm

Fruit length min7 mm

Fruit width7.5 mm

Fruit width max10 mm

Fruit width min5 mm

Leaf length17.5 mm

Leaf length max25 mm

Leaf length min10 mm

Leaf width10.5 mm

Leaf width max15 mm

Leaf width min6 mm

Plant height0.05 m

Plant height max0.06 m

Plant height min0.04 m

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max5 000 m

Elevation mean4 180 m

Elevation min2 000 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fragaria daltoniana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJX118103.1 ↗3 607 bp

ACGT

AGGGGGCTAGAAGATCTACGACTTTAATTCCTGTTTCAAAAATGGCTAATTTTGTATCTAACTGTATAAAGGCAGGCGCAGATCTATGAA …

Fragaria daltoniana ATP synthase CF1 beta subunit (atpB) gene, partial cds; ribulose 1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, complete cds; and acetyl-CoA carboxylase carboxytransferase beta subunit (accD) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL9★ITS

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Fragaria daltoniana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 149×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +4

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Iwatsubo, Y. & N. Naruhashi. 1991. Karyotypes of Fragaria nubicola and F. daltoniana (Rosaceae). Cytologia 56: 453–457.

CCDB · ipcn-api-dl — Staudt. 2006. Himalayan species of Fragaria (Rosaceae). Bot. Jahrb. Syst. 126(4): 483–508.

CCDB · book-ipcn66 — Kurosawa 1966

CCDB · book-ipcn73-74 — KUROSAWA, s. 1971. Cytological studies on some eastern Himalayan plants and their related species. The Flora of eastern Himalaya. Second report. pp. 355-364. Univ. Tokyo Press.

CCDB · book-indian_vol1 — Darrow, G.M. 1937; Kurosawa, S. 1971b

CCDB · book-indian_vol1 — Kurosawa, S. 1966

CCDB · eflora

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type59 records

Wild obs. + sensor7

Museum / vouchered39

Cultivated / captive3

Other10

Origin

Native10

Introduced2

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 3 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence39

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Herbarium of the Department of Botany, University of Tokyolocation not on record	22
Beijing, CN	5
Kunming, CN	4
CASlocation not on record	2
GZUlocation not on record	1
Xining, CN	1
South Kensington, GB	1
Edinburgh, GB	1
Natural History Museum, Tribhuvan Universitylocation not on record	1

9 institutions · 38 of 39 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Fragaria daltoniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)