Fouquieria columnaris

Kellogg ex Curran · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Fouquieriaceae/Fouquieria

At a glance

Occurrence records1 463

Data sources10

Biological traits11

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Fouquieria columnaris's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 463 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF1 463 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Fouquieria columnaris, the Boojum tree or cirio () is a tree in the ocotillo family,(Fouquieriaceae) whose other members include the ocotillos. Some taxonomists place it in the separate genus Idria. It is nearly endemic to the Baja California Peninsula (both the northern and southern states), with only a small population in the Sierra Bacha of Sonora, Mexico. The plant's English name, Boojum, was given by Godfrey Sykes of the Desert Laboratory in Tucson, Arizona and is taken from Lewis Carroll's poem "The Hunting of the Snark".Robert R. Humphrey. The Boojum and its HomeCarroll, Lewis, 1876. The Hunting of the Snark: An Agony in Eight Fits complete text of poem

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climber detailedself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition3 compounds

Compounds documented for Fouquieria columnaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Iridoids monoterpenoids3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
6Beta-Hydroxyloganin	present	LOTUS
Adoxosidic acid	present	LOTUS
loganin	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fouquieria columnaris has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences4

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSAH007892.2 ↗746 bp

ACGT

TCGATACCTGCCTAGCAGAACGACCTGTGAACTCGTCTCCAAAATGAGGTGATTCGCGGGTGGGCCTCCGGTCCCCCGTGGGGAACCTTC …

Fouquieria columnaris voucher accession 1939-0072, Desert Botanical Garden of Arizona internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 463 records

Wild obs. + sensor1 272

Museum / vouchered190

Cultivated / captive1

Range

Area of Occupancy AOO1 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 819≤1 km 89≤10 km 62>10 km 74

1 044 georeferenced · 228 without coordinates

Open the mapobservation + sensor1 272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 82≤1 km 2≤10 km 7>10 km 5

96 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence190

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	81
Phoenix, US	24
ASUlocation not on record	10
Claremont, US	10
Riverside, US	9
La Paz, MX	8
Arizona State University Biocollectionslocation not on record	7
Austin, US	6
Hermosillo, MX	5
Ensenada, MX	4
Kew, GB	4
Saint Louis, US	3
University of Stellenboschlocation not on record	3
Austin, US	3
Fort Worth, US	2
Mexico City, MX	2
Wuzhou, CN	2
Moscow, US	1
The University of Arizonalocation not on record	1
Canadian Department of Agriculturelocation not on record	1
EL PASO, US	1
Irvine, US	1
Chapingo, MX	1

23 institutions · 189 of 190 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Fouquieria columnaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Fouquieria columnaris

At a glance

Sources10 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Compound class profile1 class

Documented compounds3 total

At a glance

Record type1 463 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 463 records