Fosterella micrantha

(Lindl.) L.B.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Fosterella

At a glance

Occurrence records212

Data sources7

Biological traits7

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Fosterella micrantha's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility212 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF212 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Fosterella micrantha is a plant species in the genus Fosterella. This species is native to Mexico (Nuevo León, Veracruz, Chiapas, Oaxaca, Guerrero), Guatemala, and El Salvador.Kew World Checklist of Selected Plant FamiliesPulido-Esparza, V.A., López-Ferrari, A.R. & Espejo-Serna, A. (2004). Flora Bromeliológia del estado de Guerrero, México: riqueza y distribución. Boletin de la Sociedad Botanica de México 75: 55-104.Espejo-Serna, A. & López-Ferrari, A.R. (2005). Bromeliaceae. Flora de Veracruz 136: 1-307. Instituto Nacional de Investigaciones sobre Recursos Bióticos, Xalapa, Veracruz.Espejo-Serna, A., López-Ferrari, A.R., Martínez-Correa, N. & Pulido-Esparza, V.A. (2007). Bromeliad flora of Oaxaca, Mexico: richness and distribution. Acta Botanica Mexicana 81: 71-147. Instituto de Ecología A.C.Davidse, G., M. Sousa Sánchez & A.O. Chater. 1994. Alismataceae a Cyperaceae. 6: i–xvi, 1–543. In G. Davidse, M. Sousa Sánchez & A.O. Chater (eds.) Flora Mesoamericana. Universidad Nacional Autónoma de México, México, D. F.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or subshrub

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fosterella micrantha has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

matKHQ167791.1 ↗1 633 bp

ACGT

AAATGTAAATGGAAGAATTACAAGGATATTTTGAAAAAGATAGATCTCGGCAACAACACTTCCTATATCCGCTTCTTTTTCAGGAGTATA …

Fosterella micrantha isolate B034 tRNA-Lys (trnK) gene, intron; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4

plant barcode

07Deep time~0.58 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0.58 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type212 records

Wild obs. + sensor40

Museum / vouchered171

Other1

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 29≤1 km 4

33 georeferenced · 7 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 55≤10 km 1

56 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	30
Mexico City, MX	23
Chicago, US	22
Saint Louis, US	20
Antiguo Cuscatlán, SV	19
Tampa, US	12
Tuxtla Gutiérrez, MX	10
Berlin, DE	7
Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record	4
Ciudad de México, MX	3
Ann Arbor, US	3
Mexico City, MX	2
Universidad de El Salvadorlocation not on record	2
BMlocation not on record	2
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	2
Austin, US	1
Zürich, CH	1
Riverside, US	1
Station d'Ecologie de Lamtolocation not on record	1
Kew, GB	1
Frankfurt am Main	1
Ciudad de México, MX	1
South Kensington, GB	1
Bronx, US	1
MEXUlocation not on record	1

25 institutions · 171 of 171 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Fosterella micrantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)