Forsythia ovata

Nakai · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Oleaceae/Forsythia

At a glance

Occurrence records74

Data sources14

Biological traits12

DNA specimens2

eDNA detections3

Sources14 archives

Databases and archives Forsythia ovata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS16 compounds

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · NCBI≈1.1 Gbp

01Narrative

Forsythia ovata ( manlihwa), the Korean forsythia or early forsythia, is a species of flowering plant in the family Oleaceae, native to the Korean Peninsula. An early bloomer, it is deer resistant, and hardy to ; USDA Hardiness zone 2a.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1.25 m

Life cycle & reproduction4

Deciduousnessdeciduous

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)7.92 mm²/mg

03Chemical composition16 compounds

Compounds documented for Forsythia ovata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Dibenzylbutyrolactone lignans5

Guaiane sesquiterpenoids3

Ansa peptide alkaloids2

Flavonols1

Apotirucallane triterpenoids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Arctigenin	present	LOTUS
(-)-Arctiin	present	LOTUS
(-)-Matairesinol	present	LOTUS
(1R,2R,5R,6S,7S,10S,14R,15R,16S,21R)-6,7,16-trihydroxy-1,2,5,8,8,15,20,20-octamethyl-19-oxapentacyclo[12.9.0.02,11.05,10.015,21]tricos-11-ene-18,23-dione	present	NPASS
(2S)-2-(dimethylamino)-3-methyl-N-[(3S,4S,7S,10Z)-7-(2-methylpropyl)-5,8-dioxo-3-propan-2-yl-2-oxa-6,9-diazabicyclo[10.2.2]hexadeca-1(14),10,12,15-tetraen-4-yl]butanamide	present	NPASS
(2S,3R,4R,5R,6S)-2-[[(1S,2R,3R)-7-hydroxy-1-(4-hydroxy-3-methoxyphenyl)-3-(hydroxymethyl)-6-methoxy-1,2,3,4-tetrahydronaphthalen-2-yl]methoxy]-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3S)-2-(dimethylamino)-N-[(2Z,6S,9S,10S)-6-isobutyl-10-isopropyl-5,8-dioxo-11-oxa-4,7-diazabicyclo[10.2.2]hexadeca-1(14),2,12,15-tetraen-9-yl]-3-methyl-pentanamide	present	NPASS
(6R,8S,8aR)-6-hydroxy-3,8-dimethyl-5-propan-2-yl-6,7,8,8a-tetrahydro-1H-azulen-2-one	present	NPASS
(8S,8aR)-3,8-dimethyl-5-propan-2-yl-1,7,8,8a-tetrahydroazulene-2,6-dione	present	NPASS
(8S,8aR)-5-[(2S)-1-hydroxypropan-2-yl]-3,8-dimethyl-6,7,8,8a-tetrahydro-1H-azulen-2-one	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Forsythia ovata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences7

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT227709.1 ↗663 bpChina · 2011

ACGT

TGCAAAGCAGACCCGCGAACATGTTTTAAAATACACGGGAGGATGACGACGGTGCAGCCACCGCGCTGTCCCTCGTCAGAGCCCCGCTCC …

Forsythia ovata voucher BOP010275 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Forsythia ovata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 108 525 499 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Forsythia ovata1.11 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 287×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · slov-fl — Baranec T. & Murín A., 2003: Karyological analyses of some Korean woody plants. - Biologia (Bratislava) 58/4: 797-804.

CCDB · ipcn-api-dl — Lim, S. c. & S. c. Ko. 1989. A cytotaxonomical study on some species of Korean Forsythia. Korean J. Pl. Taxon. 19: 229–239.

CCDB · ipcn-api-dl — Baranec, T. & A. Murin. 2003. Karyological analyses of some Korean woody plants. Biologia (Bratislava) 58(4): 797–804.

CCDB · book-fedorov — O'Mara 1930

CCDB · book-fedorov — Sax K., Abbe 1932

CCDB · book-fedorov — Taylor H. 1945

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type74 records

Wild obs. + sensor18

Museum / vouchered53

Cultivated / captive3

Origin

Introduced1

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 5≤10 km 2>10 km 3

10 georeferenced · 8 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 5≤10 km 3>10 km 2

10 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence53

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Institute of Biological Resourceslocation not on record	26
University of New Hampshirelocation not on record	2
Philadelphia, US	2
Kingston, US	1
Flagstaff, US	1
Beijing, CN	1
Emporia, US	1
Trois-Rivières, CA	1
WTUlocation not on record	1
Québec, CA	1
Philadelphia, US	1
Williamsburg, US	1
Vitoria, ES	1
Edmonton, CA	1
Bangkok, TH	1

15 institutions · 42 of 53 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Forsythia ovata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 12.6–12.6

Seasonal swing summer↔winter27.3 °C

Max temp (day)16.4 °C

Min temp (night)7.40 °C

Precipitation112 mm/mo

Air humidity58.0 %

Moisture balance21.7 mm/mo

Vapour deficit690 Pa

Wind speed2.90 m/s

Cloud cover41.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)