Forsythia koreana

(Rehder) Nakai · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Oleaceae/Forsythia

At a glance

Occurrence records1 562

Data sources11

Biological traits8

DNA specimens1

eDNA detections2

Sources11 archives

Databases and archives Forsythia koreana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 562 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Chemical compositionLOTUS · NPASS27 compounds

Occurrence & distributionGBIF1 562 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Forsythia koreana, commonly called gaenari (Hangul:개나리) or Korean goldenbell tree, is a species in the olive family, Oleaceae. It grows to about 3 m. The leaves are oval in shape, have teeth, and are 3-12 cm long. The front of the leaf is dark green and the back is dark blue, but both sides are hairless.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Woodinesswoody

03Chemical composition27 compounds

Compounds documented for Forsythia koreana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Furofuranoid lignans7

Cinnamic acids and derivatives $ Phenylethanoids6

Dibenzylbutyrolactone lignans4

Phenylethanoids2

Tropane alkaloids2

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pinoresinol	present	LOTUS
(-)-Arctigenin	present	LOTUS
(-)-Arctiin	present	LOTUS
(-)-Lariciresinol	present	LOTUS
(-)-Matairesinol	present	LOTUS
(2S,3R,4S,5S,6R)-2-(4-((3S,3aR,6S,6aR)-3-(4-hydroxy-3-methoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro(3,4-c)furan-6-yl)-2-methoxyphenoxy)-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3S,4S,5R,6R)-2-[4-[(3S,3aR,6S,6aR)-3-(3,4-dimethoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-6-yl]-2-methoxyphenoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
2,3-Dihydro-5-hydroxybenzo(b)furan	present	LOTUS
4-hydroxy-4-[2-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyethyl]cyclohexa-2,5-dien-1-one	present	LOTUS
[(2R,3R,4S,5S)-2-[2-(3,4-dihydroxyphenyl)ethoxy]-4-hydroxy-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Forsythia koreana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF534806.1 ↗654 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACATGTTTTAAAATACACGGGAGGATGACGATGGTTCAGCCACCGTGCTGTCCCTCGTCAGAGC …

Forsythia viridissima var. koreana internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Forsythia koreana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×CCDB · slov-fl · CCDB · ipcn-api-dl

CCDB · slov-fl — Baranec T. & Murín A., 2003: Karyological analyses of some Korean woody plants. - Biologia (Bratislava) 58/4: 797-804.

CCDB · ipcn-api-dl — Lim, S. c. & S. c. Ko. 1989. A cytotaxonomical study on some species of Korean Forsythia. Korean J. Pl. Taxon. 19: 229–239.

CCDB · ipcn-api-dl — Weng, R. f. & M. z. Zhang. 1992. Chromosome numbers in Chinese Oleaceae I. Invest. Stud. Nat. 12: 66–77.

CCDB · ipcn-api-dl — Baranec, T. & A. Murin. 2003. Karyological analyses of some Korean woody plants. Biologia (Bratislava) 58(4): 797–804.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 562 records

Wild obs. + sensor1 478

Museum / vouchered84

Range

Area of Occupancy AOO2 940 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 45≤1 km 13≤10 km 2>10 km 4

64 georeferenced · 1 414 without coordinates

Open the mapobservation + sensor1 478

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	30
National Institute of Biological Resourceslocation not on record	26
Odawara, JP	9
DNSMlocation not on record	6
DMZ botanic gardenlocation not on record	3
Moscow State Universitylocation not on record	2
Chiba, JP	2
Korea National Arboretumlocation not on record	1
KNAMlocation not on record	1
KIWElocation not on record	1
Chongqing Museumlocation not on record	1
Parthenon Tama History Museumlocation not on record	1
Philadelphia, US	1

13 institutions · 84 of 84 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Forsythia koreana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 12.6–12.6

Seasonal swing summer↔winter27.3 °C

Max temp (day)16.4 °C

Min temp (night)7.40 °C

Precipitation112 mm/mo

Air humidity58.0 %

Moisture balance21.7 mm/mo

Vapour deficit690 Pa

Wind speed2.90 m/s

Cloud cover41.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Forsythia koreana

At a glance

Sources11 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment4

Compound class profile5 classes

Documented compounds27 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 562 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 562 records