Forsythia europaea

Degen & Bald. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Oleaceae/Forsythia

At a glance

Occurrence records168

Data sources13

Biological traits14

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Forsythia europaea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS36 compounds

Occurrence & distributionGBIF168 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Forsythia europaea, commonly known as Albanian forsythia or European forsythia, is a species of flowering plant in the olive family, with a native range from Montenegro to northern Albania. It is the only species of Forsythia native to Europe; prior to its discovery in Albania in 1897, it was thought that all Forsythia were native to East Asia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height2 m

Life cycle & reproduction5

Deciduousnessdeciduous

Life formshrub

Life spanperennial

Lifespan years16 years

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition36 compounds

Compounds documented for Forsythia europaea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Furofuranoid lignans6

Cinnamic acids and derivatives5

Simple phenolic acids4

Unsaturated fatty acids3

Iridoids monoterpenoids3

Documented compounds36 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pinoresinol	present	LOTUS
(1S,3R,4R,5S)-3-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy-1,4,5-trihydroxycyclohexane-1-carboxylic acid	present	LOTUS
(2-Methoxyphenyl)methyl 2,3,6-trimethoxybenzoate	present	NPASS
(2-Methoxyphenyl)methyl 2,6-dimethoxybenzoate	present	NPASS
(2S,3R,4S,5S,6R)-2-(4-((3S,3aR,6S,6aR)-3-(4-hydroxy-3-methoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro(3,4-c)furan-6-yl)-2-methoxyphenoxy)-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3S,4S,5R,6R)-2-[4-[(3S,3aR,6S,6aR)-3-(3,4-dimethoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-6-yl]-2-methoxyphenoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2Z,8Z)-Matricaria Acid Methyl Ester	present	NPASS
(E,Z)-Marticaria ester	present	NPASS
11-Methylforsythide	present	LOTUS
4-hydroxy-4-[2-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyethyl]cyclohexa-2,5-dien-1-one	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Forsythia europaea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU528506.1 ↗627 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACATGTTTTAAAACACACGGGAGGATGACGATGGTGCAGCCACCGCGCTGTCCCTCGTCGGAGC …

Forsythia europaea isolate PDBK1990-0050 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Forsythia europaea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — O'Mara 1930

CCDB · book-fedorov — Sax K., Abbe 1932

CCDB · book-fedorov — Taylor H. 1945

CCDB · book-atlas-flowering-plants — Sax &A. 1932

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type168 records

Wild obs. + sensor80

Museum / vouchered25

Cultivated / captive2

Other61

Origin

Introduced1

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 26≤1 km 41≤10 km 1>10 km 11

79 georeferenced · 1 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 4≤1 km 7≤10 km 1>10 km 1

13 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence25

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	3
Wlocation not on record	2
Oskarshamn, SE	1
Knoxville, US	1
BRNUlocation not on record	1
Moscow State Universitylocation not on record	1
Norfolk, US	1
GJOlocation not on record	1
Turku, FI	1
Canadian Department of Agriculturelocation not on record	1
Royal Botanical Gardenslocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Philadelphia, US	1

13 institutions · 16 of 25 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Forsythia europaea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)