Forsskaolea tenacissima

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Forsskaolea

At a glance

Occurrence records1 553

Data sources8

Biological traits20

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Forsskaolea tenacissima's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 553 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF1 553 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaTgenome

01Narrative

Forsskaolea tenacissima is a member of the non-stinging nettles genus Forsskaolea and is in the same family as the stinging kind, Urticaceae. Described as "looking like a tough character that does not want or need a caress", F. tenacissima makes its home where not many plant species survive, in stony soils, road edges, in the gravel wadi and "in the rock crevices and water-receiving depressions" above the stone pavements of the Hamadas. Forsskaolea tenacissima was named in mourning of a student of Carl Linnaeus, a Swede named Peter Forsskål, who died while gathering botanical and zoological specimens from the Arabia Felix. Linnaeus named this plant Forsskaolea tenacissima because the plant was as stubborn and persistent as the student had been.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.4 m

Seed mass9.93 mg

Seed mass max9.93 mg

Seed mass min9.93 mg

Life cycle & reproduction6

Flowering endApr

Flowering startMar

Life formperennial or subshrub

Life spanannual

⚠ sources differ — TRY: annual · GIFT: perennial

Lifespan years2 years

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 000 m

Elevation min600 m

Growth formherb

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Forsskaolea tenacissima has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR364720.1 ↗655 bpSaudi Arabia · 2022

ACGT

CTGCGGAAGGATCATTGTCGAAACCTGCCGAAGCAGAACAACCCGCGAACACGTTCCTAAAACAGCCTGCGAGCCGAGGGGGCCTCGGCC …

Forsskaolea tenacissima isolate Mecca internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS6

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Forsskaolea tenacissima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 553 records

Wild obs. + sensor1 389

Museum / vouchered162

Other2

Range

Area of Occupancy AOO3 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 307≤1 km 64≤10 km 90>10 km 27

488 georeferenced · 901 without coordinates

Open the mapobservation + sensor1 389

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 2≤1 km 30≤10 km 18>10 km 1

51 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Phyletisches Museum Jenalocation not on record	20
Kew, GB	20
Wlocation not on record	16
Berlin, DE	12
Edinburgh, GB	11
GZUlocation not on record	11
Barcelona, ES	5
Uppsala, SE	5
MAlocation not on record	5
BClocation not on record	5
Frankfurt am Main	4
PRClocation not on record	4
MeiseBGlocation not on record	4
Paris, FR	4
LDlocation not on record	2
Granada, ES	2
Stockholm, SE	2
Bronx, US	2
College of the Atlantic, Museumlocation not on record	2
QAUlocation not on record	2
Moscow State Universitylocation not on record	2
Entomological Society of Latvialocation not on record	2
GJOlocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Austin, US	1
Saint Louis, US	1
Rishon Le Zion, IL	1
South Kensington, GB	1
Alicante, ES	1
Salamanca, ES	1
Natural History Museum Rotterdamlocation not on record	1

31 institutions · 151 of 162 vouchered records shown · 11 without an institution code

09Environmental DNA1 detections

Where the DNA of Forsskaolea tenacissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Forsskaolea tenacissima

At a glance

Sources8 archives

Size & morphology4

Life cycle & reproduction6

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 553 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 553 records