Forsskaolea angustifolia

Retz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Forsskaolea

At a glance

Occurrence records1 376

Data sources11

Biological traits21

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Forsskaolea angustifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 376 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF1 376 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT313 Mbp

01Narrative

Forsskaolea angustifolia is a small shrub or perennial herb. The leaves of the plant are alternate, with dentate, prickly margins, and is densely lanate beneath, with stipules present. Its flowers are monoecious. Its inflorescences are axillary, small, and pinkish, and male flowers have one stamen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf length max30 mm

Leaf length min8 mm

Leaf width max10 mm

Leaf width min1.5 mm

Plant height0.4 m

Plant height max2 m

Plant height min0.3 m

Life cycle & reproduction7

Dehiscenceindehiscent

Flower colourpink

Flowering endJun

Flowering startJan

Life formperennial or subshrub

Life spanperennial

Lifespan years3 years

Habitat & environment4

Climatesubtropical

Fruit typedrupe

Growth formherb

⚠ sources differ — GIFT: herb · TRY: b H

Woodinessnon-woody

Other traits3

Defenseyes

Leaf arrangementalternate

Seeds per fruit1-10

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Forsskaolea angustifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences9

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF137860.1 ↗770 bp

ACGT

TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCGAAGCAGAACAACCCGCGAACACGTCACTAAAACA …

Forsskaolea angustifolia isolate 6515 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Forsskaolea angustifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size312 960 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Forsskaolea angustifolia0.31 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Suda J, Kyncl T, Freiova R. 2003. Nuclear DNA amounts in Macaronesian angiosperms. Annals of Botany 92: 153-164.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.996 ↗

08Occurrence & distribution

Record type1 376 records

Wild obs. + sensor1 306

Museum / vouchered69

Cultivated / captive1

Origin

Introduced8

Range

Area of Occupancy AOO2 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 387≤1 km 552≤10 km 190>10 km 15

1 144 georeferenced · 162 without coordinates

Open the mapobservation + sensor1 306

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 13≤1 km 5≤10 km 8

26 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence69

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College of the Atlantic, Museumlocation not on record	8
LDlocation not on record	3
Granada, ES	3
MAlocation not on record	3
Entomological Society of Latvialocation not on record	2
Vitoria, ES	2
South Kensington, GB	2
València, ES	2
Alicante, ES	2
GJOlocation not on record	2
Frankfurt am Main	2
Wlocation not on record	2
Stockholm, SE	1
Salamanca, ES	1
Moscow State Universitylocation not on record	1
John May Museum of Natural Historylocation not on record	1
BClocation not on record	1
Museo Achille Folettolocation not on record	1
Montréal, CA	1
Saint Louis, US	1
Barcelona, ES	1
WAGlocation not on record	1
Görlitz, DE	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
CICYTEXlocation not on record	1
Pamplona, ES	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Córdoba, ES	1
Phyletisches Museum Jenalocation not on record	1
Oskarshamn, SE	1
Paris, FR	1
Uppsala, SE	1
Austin, US	1

34 institutions · 55 of 69 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Forsskaolea angustifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Forsskaolea angustifolia

At a glance

Sources11 archives

Size & morphology7

Life cycle & reproduction7

Habitat & environment4

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 376 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 376 records