Forcipata loca

(DeLong & Caldwell, 1936) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Forcipata

At a glance

Occurrence records1 293

Data sources6

Biological traits0

DNA specimens12

eDNA detections9

Sources6 archives

Databases and archives Forcipata loca's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 293 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 293 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Forcipata loca is a species of leafhopper in the family Cicadellidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Forcipata loca has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

10Tmostly conserved

34Amostly conserved

79Tmostly conserved

119Gmostly conserved

190Tmostly conserved

205Amostly conserved

235Tmostly conserved

266Tmostly conserved

289Amostly conserved

295Amostly conserved

304Gvariable

313Gmostly conserved

316Amostly conserved

343Cmostly conserved

373Amostly conserved

403Tvariable

428Tvariable

439Gvariable

470Gmostly conserved

475Amostly conserved

508Tmostly conserved

526Tmostly conserved

538Amostly conserved

541Amostly conserved

547Tmostly conserved

557Tmostly conserved

578Tvariable

601Cvariable

609Tmostly conserved

610Tvariable

616Tmostly conserved

AACAATATATTTTATTTTTGGGATCTGATCAGGAATGGTTGGTATAATATTAAGAATATTAATTCGAGTAGAATTAATTGAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes3

BINs3

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Forcipata acclinasame genus3.3%Forcipata citrinellasame genus4.2%Notus flavipennissame family11.1%Notus sitkasame family11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 293 records

Wild obs. + sensor11

Museum / vouchered1 282

Range

Area of Occupancy AOO840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 7≤1 km 2≤10 km 1>10 km 1

11 georeferenced

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 14≤1 km 183≤10 km 509>10 km 3

709 georeferenced · 573 without coordinates

Open the institutions mapphysical evidence1 282

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	744
University of Guelph, Centre for Biodiversity Genomicslocation not on record	160
University of Guelphlocation not on record	115
Centre for Biodiversity Genomicslocation not on record	7
Mississippi State, US	5
North Carolina State University Insect Museumlocation not on record	4
US	3
Biodiversity Institute of Ontariolocation not on record	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
CUlocation not on record	1
OSUClocation not on record	1
Royal Saskatchewan Museumlocation not on record	1

12 institutions · 1 044 of 1 282 vouchered records shown · 238 without an institution code

09Environmental DNA9 detections

Where the DNA of Forcipata loca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

Temperate mixed forestMixed HabitatMixed habitatForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 15.4–20.8

Seasonal swing summer↔winter27.7 °C

Max temp (day)23.9 °C 18.1–25.2

Min temp (night)13.7 °C 13.2–17.5

Precipitation86.6 mm/mo 82.0–93.3

Air humidity58.9 % 58.0–60.1

Moisture balance-60.0 mm/mo -67.3–-34.0

Vapour deficit910 Pa 722–1,005

Wind speed3.60 m/s 3.30–6.70

Cloud cover43.1 % 39.6–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Forcipata loca

At a glance

Sources6 archives

At a glance

Record type1 293 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 293 records