Flindersia australis

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Flindersia

At a glance

Occurrence records1 323

Data sources9

Biological traits39

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Flindersia australis's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 323 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources39 traits

Chemical compositionNPASS94 compounds

Occurrence & distributionGBIF1 323 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 108

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology17

Fruit length70 mm

Leaf length105 mm

Leaf length max130 mm

Leaf length min24 mm

Leaf mass341 mg

Leaf mass per area118 g/m2

Leaf size19 585 mm²

⚠ sources differ — TRY: 19 585 mm² · AusTraits: 6 550 mm²

Leaf width31.5 mm

Leaf width max43 mm

Leaf width min8 mm

Plant height30 m

⚠ sources differ — GIFT: 30 m · AusTraits: 40 m

Plant height max40 m

Seed length34.5 mm

Seed mass43.99 mg

Seed mass max51.2 mg

Seed mass min34.93 mg

Seed width5.5 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dehiscencedehiscent

Flowering timeyynnnnnyyyyy

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical narrowly_obovate obovate ovate

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.61 mm²/mg

Wood density797 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition94 compounds

Compounds documented for Flindersia australis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Steroidal alkaloids17

Pregnane steroids8

Pregnane steroids $ Steroidal alkaloids8

Androstane steroids2

Ergostane steroids2

Documented compounds94 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,5S,6R,9R,12R,13R,16S)-N,6,7,13-tetramethyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icos-18-en-16-amine	present	NPASS
(1R,2S,3S,5S,6S,9S,12S,13R)-3-hydroxy-6,13-dimethyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icosa-14,17-dien-16-one	present	NPASS
(1R,2S,5S,6S,9R,12S,13R)-6,7,13-trimethyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icosa-14,17-dien-16-one	present	NPASS
(1R,2S,5S,6S,9R,12S,13R)-6-ethyl-13-methyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icosa-14,17-dien-16-one	present	NPASS
(1R,2S,5S,6S,9R,12S,13R)-N,6,13-trimethyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icosa-16,18-dien-16-amine	present	NPASS
(1R,2S,5S,6S,9R,12S,13R,16S)-7-hydroxy-N,N,6,13-tetramethyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icos-18-en-16-amine	present	NPASS
(1R,2S,5S,6S,9R,12S,13R,16S)-N,N,1,6,13-pentamethyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icos-18-en-16-amine	present	NPASS
(1R,2S,5S,6S,9R,12S,13R,16S)-N,N,1,6,7,13-hexamethyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icos-18-en-16-amine	present	NPASS
(1S,2R,5S,6R,9R,12S,13S,16R)-6,7,13-trimethyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icos-18-en-16-amine	present	NPASS
(1S,2R,5S,6R,9R,12S,13S,16R)-N,N,6,7,13-pentamethyl-7-azapentacyclo[10.8.0.02,9.05,9.013,18]icos-18-en-16-amine	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Flindersia australis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF025487.1 ↗311 bp

ACGT

CATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCGGCAGAACGACCCGC …

Flindersia australis internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Flindersia australis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 108 n = 54

Ploidypolyploid inferred

Chromosome records108–1082n range108median108mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1082×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith-White 1954b

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 323 records

Wild obs. + sensor666

Museum / vouchered304

Cultivated / captive1

Other352

Origin

Native37

Introduced6

Range

Area of Occupancy AOO3 704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 368≤1 km 52≤10 km 18>10 km 40

478 georeferenced · 188 without coordinates

Open the mapobservation + sensor666

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 91≤1 km 51≤10 km 76>10 km 33

251 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence304

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	108
Mount Annan, AU	44
Smithfield, AU	42
Museo Entomologico de Leonlocation not on record	41
Canberra, AU	34
Armidale, AU	13
Auckland, NZ	4
Wlocation not on record	3
Kew, GB	2
Bronx, US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Hobart, AU	1
James Cook Townsvillelocation not on record	1
Berlin, DE	1
Kensington, AU	1
Chicago, US	1
Christchurch, NZ	1

18 institutions · 300 of 304 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Flindersia australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 22.6–22.6

Seasonal swing summer↔winter10.3 °C

Max temp (day)26.2 °C

Min temp (night)19.4 °C

Precipitation162 mm/mo

Air humidity63.7 %

Moisture balance36.7 mm/mo

Vapour deficit992 Pa

Wind speed2.10 m/s

Cloud cover28.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Flindersia australis

At a glance

Sources9 archives

Size & morphology17

Life cycle & reproduction5

Diet & foraging1

Habitat & environment11

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds94 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 323 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 323 records