Flacourtia montana

J.Graham · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Salicaceae/Flacourtia

At a glance

Occurrence records182

Data sources8

Biological traits13

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Flacourtia montana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility182 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF182 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

山刺子（学名：）为大风子科刺篱木属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height10 m

Seed mass133 mg

Seed mass max133 mg

Seed mass min133 mg

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry2

Leaf dry-matter content (LDMC)371 mg/g

Wood density586 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Flacourtia montana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAF454736.2 ↗1 240 bp

ACGT

TGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATT …

Flacourtia montana ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Flacourtia montana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Koshy, J. K. & P. M. Mathew. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 773.

08Occurrence & distribution

Record type182 records

Wild obs. + sensor142

Museum / vouchered40

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 92≤1 km 18≤10 km 17

127 georeferenced · 15 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	17
Beijing, CN	9
Kunming, CN	5
Kew, GB	2
Guilin, CN	2
Baroda, IN	2
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
McWane Science Centerlocation not on record	1

9 institutions · 40 of 40 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Flacourtia montana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)