Flacourtia inermis

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Salicaceae/Flacourtia

At a glance

Occurrence records173

Data sources7

Biological traits16

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Flacourtia inermis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF173 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

羅比梅（学名：）为大風子科羅庚果屬下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height11.5 m

Seed mass35.4 mg

Seed mass max35.4 mg

Seed mass min35.4 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density720 mg/cm³

03Chemical composition7 compounds

Compounds documented for Flacourtia inermis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile3 classes

Cinnamic acids and derivatives5

Shikimic acids and derivatives $ Simple phenolic acids1

Dicarboxylic acids $ Hydroxy fatty acids1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3R,4S,5R)-Methyl 3-(3-(3,4-Dihydroxyphenyl)Acryloyloxy)-1,4,5-Trihydroxycyclohexanecarboxylate	present	LOTUS
3-O-Caffeoylquinic acid methyl ester	present	LOTUS
butyl (1R,3R,4S,5R)-3-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy-1,4,5-trihydroxycyclohexane-1-carboxylate	present	LOTUS
Chlorogenic acid butyl ester	present	LOTUS
L-Malic acid	present	LOTUS
Quinate	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Flacourtia inermis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMN078138.1 ↗155 535 bp

ACGT

GGCGAATGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCCAATACTCTATTT …

Flacourtia inermis chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Flacourtia inermis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Krishnan, N. 1977. Cytotaxonomical studies on Bixaceae and Samydaceae from south India with collected evidences from palynology, anatomy and biochemistry. Ph.D. Thesis, Annamalai University. 156 pp.

08Occurrence & distribution

Record type173 records

Wild obs. + sensor81

Museum / vouchered89

Other3

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 43≤1 km 17≤10 km 7

67 georeferenced · 14 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	9
National Biodiversity Institute, Costa Ricalocation not on record	9
Saint Louis, US	5
MeiseBGlocation not on record	5
Berlin, DE	4
Antiguo Cuscatlán, SV	2
Honolulu, US	2
BMlocation not on record	1
Fort Worth, US	1
South Kensington, GB	1
San José, CR	1
Burlington, US	1
Taipei, TW	1
BISHlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

15 institutions · 44 of 89 vouchered records shown · 45 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)