Fimbristylis thermalis

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Fimbristylis

At a glance

Occurrence records196

Data sources9

Biological traits13

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Fimbristylis thermalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility196 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF196 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Fimbristylis thermalis is a species of fimbry known by the common name hot springs fimbry. It is native to the southwestern United States and northern Mexico. It has been reported from Baja California, California, Arizona, Nevada, Utah and Coahuila.Flora of North AmericaKral, R. 1971. A treatment of Abildgaardia, Bulbostylis and Fimbristylis (Cyperaceae) for North America. Sida 4(2): 57–227. Fimbristylis thermalis grows in alkaline mud and sand, especially around hot springs and mineral-rich seeps. This is a thick-stemmed sedge which grows singly or in clumps and reaches maximum heights over a meter. It has a long rhizome system. It has short, flat, spiral-arranged leaves. At the top of the stem is an inflorescence of ovate, pointed spikelets, each on a long peduncle. The spikelet has many hairy bracts. The fruit is a shiny brown achene one to two millimeters long.Jepson Manual TreatmentWatson, Sereno. 1871.United States Geological Expolration of the Fortieth Parallel. Vol. 5, Botany 360–361.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.251 mg

Seed mass max0.25 mg

Seed mass min0.25 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fimbristylis thermalis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF964172.1 ↗708 bpUSA

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGTTGCCTTTACAAAACACGACCCGTGCACATGTAATGCAAAA …

Fimbristylis thermalis isolate CBP440 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Fimbristylis thermalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · eflora

CCDB · eflora

n 101×CCDB · cyper-only

CCDB · cyper-only — Kral, R.1971

08Occurrence & distribution

Record type196 records

Wild obs. + sensor57

Museum / vouchered139

Origin

Native21

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 30≤1 km 2>10 km 23

55 georeferenced · 2 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 18≤1 km 41≤10 km 15>10 km 10

84 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	23
CASlocation not on record	13
ASUlocation not on record	9
Riverside, US	9
Austin, US	9
Henderson, US	7
US	6
Austin, US	4
Phoenix, US	4
Flagstaff, US	4
San Diego, US	4
Bangkok, TH	3
Mexico City, MX	3
BAYLUlocation not on record	3
University of North Carolina at Pembrokelocation not on record	3
Bronx, US	3
Ann Arbor, US	3
Williamsburg, US	3
Durango, MX	3
Arcata, US	2
Santa Barbara, US	2
Guasave, MX	2
Green Bay, US	1
Chongqing Museumlocation not on record	1
Angwin, US	1
Oskarshamn, SE	1
Fort Worth, US	1

27 institutions · 127 of 139 vouchered records shown · 12 without an institution code

09Environmental DNA1 detections

Where the DNA of Fimbristylis thermalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)