Fimbristylis ferruginea
(L.) Vahl · speciesAt a glance
Occurrence records2 390
Data sources12
Biological traits38
DNA specimens3
eDNA detections3
Sources12 archives
Databases and archives Fimbristylis ferruginea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 387 records↗
OBISOcean Biodiversity Information System3 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics3 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Chemical compositionLOTUS9 compounds
Occurrence & distributionGBIF · OBIS2 390 records
Environmental DNA1 datasets · 1 countries3 detections
DNA & barcodingBOLD · NCBI3 specimens
Genome at a glanceCCDB2n = 10
01Narrative
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology14
Fruit length1.1 mm
Fruit width0.9 mm
Leaf length100 mm
Leaf length max3 mm
Leaf length min1.5 mm
Leaf width1 mm
Leaf width max3 mm
Leaf width min1.5 mm
Plant height0.6 m
Plant height max1.5 m
Plant height min0 m
Seed mass0.446 mg
⚠ sources differ — TRY: 0.446 mg · AusTraits: 0.421 mg · GIFT: 0.592 mg
Seed mass max0.955 mg
Seed mass min0.35 mg
Life cycle & reproduction10
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endAug
Flowering startJun
Flowering timeyynnnnnnyyyy
Life formperennial or rhizomatous geophyte
Life spanperennial
Pollination syndromewind
Raunkiær life formhemicryptophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 365 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFThalophytic vegetation, dense secondary shrub and ruderal vegetation
Leaf compoundnesssimple
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC4
03Chemical composition9 compounds
Compounds documented for Fimbristylis ferruginea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Noreudesmane sesquiterpenoids3
Flavones1
Aurones1
Aromatic polyketides with side chains1
Documented compounds9 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-Acetyl-4,8-dihydro-5-methylbenzo[1,2-b:5,4-b']difuran-4,8-dione | present | LOTUS | |
| 2-Prop-1-en-2-ylfuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| 3-[(Z)-heptadec-8-enyl]-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione | present | LOTUS | |
| 5-Methyl-2-prop-1-en-2-yl-2,3,5,6-tetrahydrofuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| Aureusidin | present | LOTUS | |
| BENZO(1,2-b:5,4-b')DIFURAN-4,8-DIONE, 2,3-DIHYDRO-2-ISOPROPENYL-5-METHYL-, (-)- | present | LOTUS | |
| Benzo[1,2-b:5,4-b']difuran-4,8-dione, 2-[1-(hydroxymethyl)vinyl]-5-methyl- | present | LOTUS | |
| Cyperaquinone | present | LOTUS | |
| Tricin | present | LOTUS |
05DNA & barcoding3 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fimbristylis ferruginea has left across the world's sequence archives.
At a glance
DNA specimens3
Marker genes2
GenBank sequences5
eDNA detections3
Countries2
The DNA barcodea real sequence read deposited for this species
TTGTTGCCTATACAAAACACGACCTGTGCACATGTAATGCAAAACTGCTGAGGGGAAATGTTCTCCTCAGCCCAACCGGCCTCAATCTTC …
Fimbristylis ferruginea voucher 20101102 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL1★ITS4
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Fimbristylis ferruginea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Chromosome records10–322n range10median10mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1014×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +4
CCDB · cyper-only — Sharma, A. K. & A. K. Sarkar19671968
CCDB · cyper-only — Sharma, A. K.1970
CCDB · cyper-only — Nijalingappa, B. H. M.1972
CCDB · cyper-only — Sanyal, B. & A. Sharma1972a
CCDB · cyper-only — Nijalingappa, B. H. M.1975a
CCDB · ipcn-api-dl — Nijalingappa, B. H. M. 1975. Cytological studies in Fimbristylis (Cyperaceae). Cytologia 40: 177–183.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn72 — NIJALINGAPPA, B.H.M. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn72 — SANYAL, B., & A. SHARMA. 1972. Cytological studies in Indian Cyperaceae. I. Tribe Scirpeae. Cytologia 37: 13-32.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-ipcn75-78 — Nijalingappa 1975
CCDB · book-indian_vol2 — Sharma, A. & Sarkar, A.K. 1967- 1968 ; Nijalingappa, B.H.M. 1972, 1975a ; Sanyal, B. & Sharma, A. 1972 ; Mehra, P.N. & Sachdeva, S.K. 1975b, 1976f; Rath, S.P. & Patnaik, S.N. 1978a, b
CCDB · CromoCat 2015 — Nijalingappa, B. H. M. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVIII]. Taxon 21(5/6): 683.
2n 205×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
CCDB · cyper-only — Sarkar, A. K., M. Chakraborty, N. C. Saha, S. K. Das. & D. Hazra1978
CCDB · ipcn-api-dl — Sarkar, A. K., M. CHAKRABORTY, N. C. SAHA, S. K. DAS & D. HAZRA. 1978b. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · book-ipcn75-78 — Sarkar et al. 1978 b
CCDB · book-indian_vol2 — Sarkar, A.K., Chakraverty, M. el a/. 1978
CCDB · CromoCat 2015 — Sarkar, A.K.,M.Chakraverty, N.C.Saha, S.K.Das & D.Hazra. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 521.
2n 323×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · cyper-only — Subramanian, D.1988
CCDB · ipcn-api-dl — Subramanian, D. 1988. Cytotaxonomical studies in south Indian Cyperaceae I. Species from the plains. Cytologia 53: 67–72.
CCDB · CromoCat 2015 — Subramanian, D. (1988). Cytological studies of some mangrove flora of Tamilnadu Cytologia 53: 87-92
n 516×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1975a
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1976
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978b
CCDB · cyper-only — Bir, S. S., G. S. Chatha & M. K. Sidhu1985
CCDB · cyper-only — Bir, S. S., M. K. Sidhu & S. Kamra1986
CCDB · cyper-only — Bir, S. S., S. Kamra, M. K. Sidhu & P. Cheema1988b
CCDB · cyper-only — Bir, S. S., G. S. Chatha & M. K. Sidhu1992a
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1978. Cytological studies in Cyperaceae. Proc. Indian Sci. Congr. Assoc. (III, C) 65: 107–108.
CCDB · ipcn-api-dl — Bir, S. S., S. Kamra, M. Sidhu & P. Cheema. 1988. Cytomorphological studies on some members of Cyperaceae from north India. J. Cytol. Genet. 23: 14–37.
CCDB · ipcn-api-dl — Bir, S. S., G. S. Chatha & M. Sidhu. 1992. Intraspecific variation in Cyperaceae from Punjab Plain, India. Willdenowia 22: 133–142.
CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1975a. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.
CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1976e. Cytology of some sedges from northwest India. Cytologia 41: 585–590.
CCDB · ipcn-api-dl — Mehra, P. N. & V. KALIA. 1975. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.
CCDB · book-ipcn75-78 — Mehra & Sachdeva 1976e
CCDB · book-ipcn75-78 — Mehra & Sachdeva 1975a
CCDB · CromoCat 2015 — Mehra, P. N. & S. K. Sachdeva. (1975). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIX]. Taxon 24(4): 502-503.
n 107×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · cyper-only — Bir, S. S., P. Cheema & M. K. Sidhu1988a
CCDB · cyper-only — Bir, S. S., P. Cheema & M. K. Sidhu1992b
CCDB · cyper-only — Paramjeet, C., S. Kumari, M. K. Sidhu & S. S. Bir1992
CCDB · ipcn-api-dl — Bir, S. S., P. Cheema & M. Sidhu. 1988. SOCGI plant chromosome number reports -- VII. J. Cytol. Genet. 23: 219–228.
CCDB · ipcn-api-dl — Paramjeet, C., S. Kumari, M. Sidhu & S. S. Bir. 1992. Karyomorphology of Fimbristylis from Punjab. J. Cytol. Genet. 27: 163–173.
CCDB · ipcn-api-dl — Bir, S. S., P. Cheema & M. K. Sidhu. 1992. Chromosomal analysis of Fimbristylis Vahl in Punjab, north west India. Proc. Indian Natl. Sci. Acad., B 58: 63–70.
CCDB · CromoCat 2015 — Bir, S. S., Cheema, P., Sidhu, M. (1992). Chromosomal analysis of Fimbristylis Vahl in Punjab, north west India Proceedings of the Indian National Science Academy. Part B, Biological Sciences 58: 63-70
n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Briggs, B. G., E. Edgar, K. L. Wilson & R. Snow. 2002. Chromosome numbers of some native and naturalised plant species in Australia. Telopea 9: 833–835.
08Occurrence & distribution
Record type2 390 records
Wild obs. + sensor736
Museum / vouchered1 524
Other130
Origin
Native162
Range
Area of Occupancy AOO6 060 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 218≤1 km 22≤10 km 37>10 km 27
304 georeferenced · 432 without coordinates
Open the mapobservation + sensor736
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 198≤1 km 109≤10 km 314>10 km 93
714 georeferenced · 810 without coordinates
Open the institutions mapphysical evidence1 524
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions60 of 108 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brisbane, AU | 263 |
| Mount Annan, AU | 114 |
| Palmerston, AU | 109 |
| Pretoria, ZA | 82 |
| Kew, GB | 58 |
| Bronx, US | 49 |
| MeiseBGlocation not on record | 43 |
| Paris, FR | 42 |
| Saint Louis, US | 42 |
| Canberra, AU | 42 |
| Museo Entomologico de Leonlocation not on record | 41 |
| Kensington, AU | 40 |
| Université de Strasbourglocation not on record | 26 |
| Adelaide, AU | 22 |
| University of Stellenboschlocation not on record | 22 |
| Baroda, IN | 21 |
| Armidale, AU | 20 |
| Durban, ZA | 20 |
| Smithfield, AU | 17 |
| Taipei, TW | 17 |
| Xiamen, CN | 16 |
| Edinburgh, GB | 14 |
| St. Augustine, TT | 12 |
| Pondicherry, IN | 11 |
| Guangzhou, CN | 10 |
| Forest Herbarium Ibadan (FHI)location not on record | 10 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 9 |
| Olocation not on record | 9 |
| John T. Waterhouse Herbariumlocation not on record | 8 |
| KR | 8 |
| Herbier National du Gabonlocation not on record | 6 |
| LSF/FSA/UAClocation not on record | 6 |
| HNBlocation not on record | 6 |
| LBVlocation not on record | 6 |
| TAIElocation not on record | 6 |
| Mexico City, MX | 5 |
| Christchurch, NZ | 5 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 5 |
| WAGlocation not on record | 5 |
| Mérida, MX | 5 |
| Plocation not on record | 5 |
| Dehra Dun, IN | 5 |
| James Cook Townsvillelocation not on record | 5 |
| South Kensington, GB | 4 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 4 |
| Guangzhou, CN | 4 |
| Montréal, CA | 4 |
| EL PASO, US | 3 |
| Beijing, CN | 3 |
| Tampa, US | 3 |
| Taipei, TW | 3 |
| Museu Paraense Emílio Goeldilocation not on record | 3 |
| León, NI | 3 |
| Universidade Federal de Sergipe (UFS)location not on record | 3 |
| CNF-UFHBlocation not on record | 3 |
| Honolulu, US | 3 |
| Masindi, UG | 3 |
| Hobart, AU | 3 |
| ASUlocation not on record | 3 |
| Moscow State Universitylocation not on record | 2 |
| Wellington, NZ | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 2 |
| JBRJlocation not on record | 2 |
| IPHAMETRAlocation not on record | 2 |
| Nanjing, CN | 2 |
| Hangzhou, CN | 2 |
| MAlocation not on record | 2 |
| Pullman, US | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| Indian Institute of Science (IISc)location not on record | 1 |
| Uppsala, SE | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Tapachula, MX | 1 |
| Kyoto Universitylocation not on record | 1 |
| Bratislava, SK | 1 |
| Burlington, US | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Riverside, US | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Toronto, CA | 1 |
| Frankfurt am Main | 1 |
| Auckland, NZ | 1 |
| Yaoundé, CM | 1 |
| Taipei, TW | 1 |
| BISHlocation not on record | 1 |
| València, ES | 1 |
| Mérida, MX | 1 |
| Haramaya Universitylocation not on record | 1 |
| Pennsylvania Department of Agriculturelocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Zürich, CH | 1 |
| Glocation not on record | 1 |
| Miami, US | 1 |
| Chapel Hill, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| Berlin, DE | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Chicago, US | 1 |
| BGPAlocation not on record | 1 |
| Mexico City, MX | 1 |
| Museum of Zoologylocation not on record | 1 |
| Chaguaramas, TT | 1 |
| Universidad Pablo de Olavidelocation not on record | 1 |
108 institutions · 1 378 of 1 524 vouchered records shown · 146 without an institution code
09Environmental DNA3 detections
Where the DNA of Fimbristylis ferruginea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.6 °C 24.6–24.6
Seasonal swing summer↔winter13.3 °C
Max temp (day)31.8 °C
Min temp (night)18.2 °C
Precipitation5.60 mm/mo
Air humidity44.7 %
Moisture balance-113 mm/mo
Vapour deficit1,700 Pa
Wind speed2.50 m/s
Cloud cover6.70 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.