Fimbristylis dichotoma
(L.) Vahl · speciesAt a glance
Occurrence records22 410
Data sources13
Biological traits52
DNA specimens17
eDNA detections38
Sources13 archives
Databases and archives Fimbristylis dichotoma's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility22 387 records↗
OBISOcean Biodiversity Information System23 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources52 traits
Chemical compositionLOTUS6 compounds
Occurrence & distributionGBIF · OBIS22 410 records
Environmental DNA2 datasets · 5 countries38 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB · GIFT2n = 20
01Narrative
テンツキ は、カヤツリグサ科テンツキ属の植物である。英名はない。
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology20
Fruit length1.1 mm
Fruit length max1.2 mm
Fruit length min0.8 mm
Fruit width0.85 mm
Inflorescence length max10 cm
Inflorescence length min20 cm
Leaf length max100 mm
Leaf mass per area178 g/m2
Leaf width3.25 mm
Leaf width max5 mm
Leaf width min1.5 mm
Plant height0.4 m
⚠ sources differ — GIFT: 0.4 m · AusTraits: 0.5 m · TRY: 0.263 m
Plant height max1.25 m
Plant height min0 m
Seed mass0.2 mg
⚠ sources differ — TRY: 0.2 mg · AusTraits: 0.167 mg · GIFT: 0.21 mg
Seed mass max0.51 mg
Seed mass min0.068 mg
Seed volume0.37 mm³
Seed volume max0.37 mm³
Seed volume min0.37 mm³
Life cycle & reproduction13
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — AusTraits: epizoochory · GIFT: hydrochorous
Flower colouryellow
Flowering endAug
Flowering startAug
Flowering timeyynnnnnnyyyy
Life formannual or perennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: perennial · GIFT: perennial
Pollination syndromewind
Raunkiær life formtherophyte
Resprouting capacityresprouts
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max3 200 m
Elevation mean1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica, Campinarana, Campo de Várzea, Campo Limpo, Manguezal, Palmeiral, Restinga
Leaf compoundnesssimple
Mycorrhiza type0.02008568
Succulenceno
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Other traits1
Shoot orientationascending
03Chemical composition6 compounds
Compounds documented for Fimbristylis dichotoma across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Anthocyanidins3
Flavones2
Aurones1
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Aureusidin | present | LOTUS | |
| Cyanidin | present | LOTUS | |
| Delphinidin 3-xyloside 7-rhamnosylglucoside | present | LOTUS | |
| Luteolin 7-diglucoside | present | LOTUS | |
| Tricin | present | LOTUS |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fimbristylis dichotoma has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes4
GenBank sequences10
eDNA detections38
Countries8
The DNA barcodea real sequence read deposited for this species
GGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCATCCTGAGGGCACGCCTGCCTCATGGG …
Fimbristylis dichotoma voucher MC141 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★ITS9★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Fimbristylis dichotoma carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× diploid · measured
Chromosome records10–322n range20median20mode68records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2034×CCDB · iapt · CCDB · cyper-only · CCDB · ipcn-api-dl +6
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · cyper-only — Tanaka, N.1939d
CCDB · cyper-only — 284Sharma, A. K. & A. K. Bal1956
CCDB · cyper-only — Nijalingappa, B. H. M.1972
CCDB · cyper-only — Sanyal, B. & A. Sharma1972a
CCDB · cyper-only — 284Sanyal, B. & A. Sharma1972a
CCDB · cyper-only — 286Sanyal, B. & A. Sharma1972a
CCDB · cyper-only — Baquar, S. R.1978
CCDB · cyper-only — 284Sarkar, A. K., M. Chakraborty, N. C. Saha, S. K. Das. & D. Hazra1978
CCDB · cyper-only — 287Sharma, A. K.1970
CCDB · cyper-only — 287Sanyal, B. & A. Sharma1972a
CCDB · cyper-only — 290Sanyal, B. & A. Sharma1972b
CCDB · cyper-only — 288Rath, S. P. & S. N. Patnaik1978a
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — Yano. 2006. Phylogenetic relationships and chromosome evolution of Japanese Fimbristylis (Cyperaceae) using nrDNA ITS and ETS 1f sequence data. Acta Phytotax. Geobot. 57: 205–217.
CCDB · book-ipcn72 — NIJALINGAPPA, B.H.M. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn72 — SANYAL, B., & A. SHARMA. 1972. Cytological studies in Indian Cyperaceae. I. Tribe Scirpeae. Cytologia 37: 13-32.
CCDB · book-ipcn75-78 — Baquar 1978
CCDB · book-ipcn75-78 — Sarkar et al. 1978b
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-indian_vol2 — Mehra, P.N. & Sachdeva, S.K. 1971, 1975b, 1976f; Nijalingappa, B.H.M. 1972, 1973a ; Rath, S.P. & Patnaik, S.N. 1972, 1974b; Sanyal, B. & Sharma, A. 1972 ; Baquar, S.R. '1.978
CCDB · book-indian_vol2 — Tanaka, N. 1939d
CCDB · book-indian_vol2 — Sharma, A.K. & Bal, A.K. 1954, 1956b ; Sanyal, B. & Sharma, A. 1972 ; Sarkar, A.K., Chakraverty, M. et al. '1978
CCDB · book-indian_vol2 — Sanyal, B. & Sharma, A. 1972
CCDB · book-indian_vol2 — Rath, S.P. & Patnaik, S.N. 1978a
CCDB · book-fedorov — Tanaka N. 1939e
CCDB · book-fedorov — Sharma A. K., Bal 1956b
CCDB · Cave1956 — Sharma & Bal b
GIFT · GIFT (floras)
2n 1015×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +6
CCDB · cyper-only — Sharma, A. K. & A. K. Bal.1956
CCDB · cyper-only — Murin, A. & I. I. Chaudhri1970
CCDB · cyper-only — 289Kral, R.1971
CCDB · cyper-only — 289Kessler, J. W.1983
CCDB · ipcn-api-dl — Kessler, J. W. 1983. In IOPB chromosome number reports LXXIX. 32: 322–323.
CCDB · book-ipcn67-71 — MURIN, A., & I.I. CHAUDHRI. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269. 70-322 NAG, K.K., & B.M. JOHRI. 1969. Organogenesis and chromosomal constitution in embryo callus of Nuytsia floribunda. Phytomorphology 19: 405-408.
CCDB · book-ipcn67-71 — KRAL, R. 1971. A treatment of Abildgardia, Bulbostylis, and Fimbristylis for North America. Sida 4: 57-227.
CCDB · book-ipcn75-78 — NA
CCDB · book-indian_vol2 — Sharma, A.K. & Bal, A.K. 1954, 1956b ; Sharma, B.R. 1962; Murin, A. & Chaudhri, I.I. 1970
CCDB · book-indian_vol2 — Rath, S.P. & Patnaik, S.N. 1972, 1974b ; Mehra, P.N. & Sachdeva, S.K. 1975a
CCDB · eflora
CCDB · book-fedorov — Sharma A. K., Bal 1956b
CCDB · book-fedorov — Sharma B. R. 1962
CCDB · Cave1956 — Sharma & Bal b
GIFT · GIFT (floras)
2n 3012×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3
CCDB · cyper-only — 285Kessler, J. W.1983
CCDB · cyper-only — 288Sanyal, B. & A. Sharma1972a
CCDB · ipcn-api-dl — Kessler, J. W. 1983. In IOPB chromosome number reports LXXIX. 32: 322–323.
CCDB · ipcn-api-dl — Yano. 2006. Phylogenetic relationships and chromosome evolution of Japanese Fimbristylis (Cyperaceae) using nrDNA ITS and ETS 1f sequence data. Acta Phytotax. Geobot. 57: 205–217.
CCDB · book-ipcn72 — SANYAL, B., & A. SHARMA. 1972. Cytological studies in Indian Cyperaceae. I. Tribe Scirpeae. Cytologia 37: 13-32.
CCDB · book-indian_vol2 — Kral, R. 1971
CCDB · book-indian_vol2 — Rath, S.P. & Patnaik, S.N. 1978a, b
CCDB · book-indian_vol2 — Sanyal, B. & Sharma, A. 1972 ; Rath, S.P. & Patnaik, S.N. 1975
CCDB · eflora
GIFT · GIFT (floras)
2n 125×CCDB · cyper-only · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 +1
CCDB · cyper-only — Hsu, C.-C.1967
CCDB · cyper-only — Hsu, C.-C.1972
CCDB · book-ipcn67-71 — HSU, C.-c. 1967. Preliminary chromosome studies on the vascular plants of Taiwan (I). Taiwania No. 13: 117-130.
CCDB · book-indian_vol2 — Hsu, C.-C. 1967, 1972
GIFT · GIFT (floras)
2n 322×CCDB · cyper-only · CCDB · ipcn-api-dl
CCDB · cyper-only — Subramanian, D.1988
CCDB · ipcn-api-dl — Subramanian, D. 1988. Cytotaxonomical studies in south Indian Cyperaceae I. Species from the plains. Cytologia 53: 67–72.
n 518×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · cyper-only — Sharma, B. R.1962
CCDB · cyper-only — 284Rath, S. P. & S. N. Patnaik1972
CCDB · cyper-only — 284Rath, S. P. & S. N. Patnaik1974b
CCDB · cyper-only — 284Mehra, P. N. & S. K. Sachdeva1975b
CCDB · cyper-only — Sachdeva, S. K.1977
CCDB · cyper-only — 284Sachdeva, S. K.1977
CCDB · cyper-only — Rath, S. P.1992
CCDB · cyper-only — 289Kral, R.1971
CCDB · ipcn-api-dl — Rath, S. P. 1992. Amphidiploidy in Fimbristylis dichotoma complex (Cyperaceae) [abstract]. Cell Chromosome Res. 15(3): 22.
CCDB · ipcn-api-dl — Sachdeva, S. K. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · book-ipcn67-71 — KRAL, R. 1971. A treatment of Abildgardia, Bulbostylis, and Fimbristylis for North America. Sida 4: 57-227.
CCDB · book-ipcn75-78 — Sachdeva 1977
CCDB · book-ipcn75-78 — NA
CCDB · book-ipcn75-78 — Mehra & Sachdeva 1975
CCDB · book-ipcn73-74 — RATH, S.P., S.N. PATNAIK. 1972. Cytotaxonomic studies in the Cyperaceae. Proc. Indian Sci. Congr. Assoc. 59: 361.
CCDB · book-ipcn73-74 — RATH, S.P., & S.N. PATNAIK. 1974. Cytological studies in Cyperaceae with special reference to its taxonomy I. Cytologia 39: 341-352.
CCDB · Cave1962 — Sharma 1962
n 1018×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1971
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1972
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1974b
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1975a
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1976
CCDB · cyper-only — 284Mehra, P. N. & S. K. Sachdeva1979
CCDB · cyper-only — Paramjeet, C., S. Kumari, M. K. Sidhu & S. S. Bir1992
CCDB · cyper-only — 288Sharma, A. K.1970
CCDB · ipcn-api-dl — Paramjeet, C., S. Kumari, M. Sidhu & S. S. Bir. 1992. Karyomorphology of Fimbristylis from Punjab. J. Cytol. Genet. 27: 163–173.
CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1975a. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.
CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1976e. Cytology of some sedges from northwest India. Cytologia 41: 585–590.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — MEHRA, P.N . & S.K. SACHDEVA. 1971. In IOPB chromosome reports XXXIII. Taxon 20: 609-614.
CCDB · book-ipcn75-78 — Mehra & Sachdeva 1976e
CCDB · book-ipcn75-78 — Mehra & Sachdeva 1975a
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-ipcn73-74 — RATH, S.P., S.N. PATNAIK. 1972. Cytotaxonomic studies in the Cyperaceae. Proc. Indian Sci. Congr. Assoc. 59: 361.
CCDB · book-ipcn73-74 — RATH, S.P., & S.N. PATNAIK. 1974. Cytological studies in Cyperaceae with special reference to its taxonomy I. Cytologia 39: 341-352.
n 1512×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · cyper-only — Kral, R.1971
CCDB · cyper-only — 285Kral, R.1971
CCDB · cyper-only — 288Rath, S. P. & S. N. Patnaik1975
CCDB · cyper-only — 290Rath, S. P. & S. N. Patnaik1978b
CCDB · cyper-only — 288Rath, S. P.1992
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1978. Cytological studies in Cyperaceae. Proc. Indian Sci. Congr. Assoc. (III, C) 65: 107–108.
CCDB · ipcn-api-dl — Rath, S. P. 1992. Amphidiploidy in Fimbristylis dichotoma complex (Cyperaceae) [abstract]. Cell Chromosome Res. 15(3): 22.
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1975. Cytological studies in Cyperaceae. Proc. Indian Sci. Congr. Assoc. 62: 127–128.
CCDB · ipcn-api-dl — Yano. 2006. Phylogenetic relationships and chromosome evolution of Japanese Fimbristylis (Cyperaceae) using nrDNA ITS and ETS 1f sequence data. Acta Phytotax. Geobot. 57: 205–217.
CCDB · book-ipcn67-71 — KRAL, R. 1971. A treatment of Abildgardia, Bulbostylis, and Fimbristylis for North America. Sida 4: 57-227.
CCDB · book-ipcn75-78 — Rath & Patnaik 1975
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type22 410 records
Wild obs. + sensor10 180
Museum / vouchered10 860
Cultivated / captive3
Other1 367
Origin
Native1 767
Introduced46
Range
Area of Occupancy AOO50 712 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy96% within 1 km
≤100 m 7 578≤1 km 493≤10 km 202>10 km 125
8 398 georeferenced · 1 782 without coordinates
Open the mapobservation + sensor10 180
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 990≤1 km 389≤10 km 1 583>10 km 475
3 437 georeferenced · 7 423 without coordinates
Open the institutions mapphysical evidence10 860
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 1
1 georeferenced · 2 without coordinates
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions178 of 402 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brisbane, AU | 904 |
| Saint Louis, US | 701 |
| Kew, GB | 597 |
| Mount Annan, AU | 469 |
| Palmerston, AU | 340 |
| Bronx, US | 337 |
| Canberra, AU | 259 |
| Museo Entomologico de Leonlocation not on record | 215 |
| Taipei, TW | 196 |
| Université de Bordeauxlocation not on record | 193 |
| MeiseBGlocation not on record | 193 |
| Adelaide, AU | 148 |
| National Biodiversity Institute, Costa Ricalocation not on record | 147 |
| Guangzhou, CN | 144 |
| Armidale, AU | 131 |
| Chiba, JP | 128 |
| Forest Herbarium Ibadan (FHI)location not on record | 117 |
| University of Stellenboschlocation not on record | 117 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 114 |
| NSMKlocation not on record | 106 |
| Kensington, AU | 102 |
| Durango, MX | 96 |
| Mexico City, MX | 96 |
| Porto Alegre, BR | 93 |
| Jackson, US | 88 |
| HNBlocation not on record | 68 |
| Smithfield, AU | 67 |
| Durban, ZA | 65 |
| Tampa, US | 65 |
| Jena Microbial Resource Collectionlocation not on record | 64 |
| Sanda, JP | 63 |
| UFMSlocation not on record | 57 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 56 |
| Beijing, CN | 55 |
| Xiamen, CN | 54 |
| WAGlocation not on record | 54 |
| Taipei, TW | 52 |
| Nagatoro-machi, Chichibu-gun, JP | 49 |
| Yaoundé, CM | 48 |
| Paris, FR | 48 |
| UnBlocation not on record | 48 |
| Université de Strasbourglocation not on record | 47 |
| Ann Arbor, US | 44 |
| Masindi, UG | 44 |
| Guilin, CN | 43 |
| San Isidro, AR | 41 |
| Universidade Federal de Sergipe (UFS)location not on record | 41 |
| St. Augustine, TT | 39 |
| Cenargenlocation not on record | 39 |
| Museu Paraense Emílio Goeldilocation not on record | 39 |
| Honolulu, US | 38 |
| Blumenau, BR | 38 |
| Universidad Nacional de Colombia (UNAL)location not on record | 37 |
| Plocation not on record | 37 |
| Auckland, NZ | 36 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 36 |
| Baroda, IN | 34 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 34 |
| MAlocation not on record | 32 |
| TAIElocation not on record | 32 |
| Ciudad de México, MX | 31 |
| Taipei, TW | 31 |
| Brasília, BR | 29 |
| UFPElocation not on record | 29 |
| Altos de Pipe, VE | 29 |
| Tomioka, JP | 29 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 28 |
| Austin, US | 28 |
| Durham, US | 27 |
| Bando, JP | 27 |
| Yangling, CN | 27 |
| Salvador, BR | 26 |
| JBRJlocation not on record | 26 |
| LBVlocation not on record | 25 |
| John T. Waterhouse Herbariumlocation not on record | 25 |
| Universidade Federale do Rio Grande do Sullocation not on record | 25 |
| UFSClocation not on record | 25 |
| León, NI | 24 |
| Osaka, JP | 24 |
| Herbier National du Gabonlocation not on record | 23 |
| Fort Worth, US | 23 |
| Puerto Ayora, EC | 23 |
| Aarhus, DK | 21 |
| Brasília, BR | 21 |
| Corrientes, AR | 20 |
| Universidade Federal de Santa Catarinalocation not on record | 20 |
| San José, CR | 20 |
| University of Papua New Guinealocation not on record | 20 |
| Wuhan, CN | 20 |
| BISHlocation not on record | 19 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 19 |
| Laboratorio de Ictiologialocation not on record | 19 |
| National Institute of Biological Resourceslocation not on record | 19 |
| Seoul, KR | 19 |
| Université National du Béninlocation not on record | 18 |
| BIO-UNIPIlocation not on record | 18 |
| South Kensington, GB | 17 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 17 |
| Edinburgh, GB | 17 |
| UFBAlocation not on record | 16 |
| Bangkok, TH | 16 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 16 |
| Chengdu, CN | 15 |
| Changsha, CN | 15 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 15 |
| CNF-UFHBlocation not on record | 15 |
| Riverside, US | 15 |
| Pretoria, ZA | 14 |
| Guangzhou, CN | 14 |
| Moscow State Universitylocation not on record | 14 |
| Université du Lomélocation not on record | 14 |
| Christchurch, NZ | 14 |
| UNICAMPlocation not on record | 14 |
| Wollongong, AU | 13 |
| Awka, NG | 13 |
| Tall Timbers Research Stationlocation not on record | 12 |
| EL PASO, US | 12 |
| Chaguaramas, TT | 12 |
| Frankfurt am Main | 12 |
| Pullman, US | 12 |
| Cuiabá, BR | 12 |
| Paleontological Collectionlocation not on record | 12 |
| KURAlocation not on record | 12 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 12 |
| Kyoto Universitylocation not on record | 11 |
| Ilhéus, BR | 11 |
| CEPLAClocation not on record | 11 |
| Valdosta State Universitylocation not on record | 11 |
| Mérida, MX | 11 |
| Feira de Santana, BR | 11 |
| Berlin, DE | 11 |
| Brussels, BE | 11 |
| UTFPR-CPlocation not on record | 11 |
| US | 11 |
| USP-IBlocation not on record | 10 |
| Chongqing Museumlocation not on record | 10 |
| IECOSlocation not on record | 10 |
| Kunming, CN | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Miami, US | 9 |
| Glocation not on record | 9 |
| ASUlocation not on record | 9 |
| FUVATESlocation not on record | 9 |
| Austin, US | 9 |
| Campo Mourão, BR | 9 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 9 |
| GAlocation not on record | 8 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 8 |
| James Cook Townsvillelocation not on record | 8 |
| UEPAlocation not on record | 8 |
| Wlocation not on record | 8 |
| Antiguo Cuscatlán, SV | 8 |
| Tuxtla Gutiérrez, MX | 8 |
| UNESClocation not on record | 8 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 8 |
| NSW Office of Environment and Heritagelocation not on record | 8 |
| Criciúma, BR | 7 |
| UFSJlocation not on record | 7 |
| Santa Cruz de la Sierra, BO | 7 |
| Nanjing, CN | 7 |
| Tianjin Natural History Museumlocation not on record | 7 |
| CJBGlocation not on record | 7 |
| Wuzhou, CN | 7 |
| Dehra Dun, IN | 7 |
| Hangzhou, CN | 7 |
| UFMGlocation not on record | 7 |
| IPA/SPlocation not on record | 7 |
| Olocation not on record | 7 |
| UNIVASFlocation not on record | 7 |
| TNMlocation not on record | 7 |
| Zürich, CH | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 7 |
| DMZ botanic gardenlocation not on record | 7 |
| Hobart, AU | 6 |
| La Paz, BO | 6 |
| Wellington, NZ | 6 |
| Nagasaki University - Fisherieslocation not on record | 6 |
| KR | 6 |
| Universidad Pablo de Olavidelocation not on record | 6 |
| Beijing, CN | 6 |
| Ciudad Autónoma de Buenos Aires, AR | 6 |
| BRLUlocation not on record | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| DanBIFlocation not on record | 6 |
| University of Hamburglocation not on record | 6 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 6 |
| LDlocation not on record | 6 |
| BAYLUlocation not on record | 6 |
| Ivano-Frankivsk, UA | 6 |
| KOMlocation not on record | 6 |
| Pondicherry, IN | 5 |
| UNITINSlocation not on record | 5 |
| Elocation not on record | 5 |
| Batemans Bay, AU | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| Tuscaloosa, US | 5 |
| Autlán de Navarro, MX | 5 |
| San Angelo, US | 5 |
| UNESP-ISlocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Uppsala, SE | 5 |
| Forestry Research Institute of Nigerialocation not on record | 5 |
| ifplocation not on record | 5 |
| Norfolk, US | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Kochi, JP | 5 |
| MEXUlocation not on record | 5 |
| QCNElocation not on record | 5 |
| Tokushima, JP | 5 |
| Teresina, BR | 5 |
| Seychelles National Herbariumlocation not on record | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 4 |
| Loja, EC | 4 |
| Jishou Universitylocation not on record | 4 |
| Zhejiang Universitylocation not on record | 4 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 4 |
| Leiden University Medical Centerlocation not on record | 4 |
| UFRPElocation not on record | 4 |
| Museum of Zoologylocation not on record | 4 |
| Londrina, BR | 4 |
| GENTlocation not on record | 4 |
| 盐城国家级珍禽自然保护区location not on record | 4 |
| Ishikawa Museum of Natural Historylocation not on record | 4 |
| Sucre, BO | 4 |
| Columbia, US | 4 |
| Tapachula, MX | 4 |
| Parkville, AU | 4 |
| Chicago, US | 4 |
| Fortaleza, BR | 3 |
| Bloomington, US | 3 |
| Görlitz, DE | 3 |
| CC BYlocation not on record | 3 |
| Xining, CN | 3 |
| Ural Federal University "B. N. Yeltsin"location not on record | 3 |
| Peking Universitylocation not on record | 3 |
| Flagstaff, US | 3 |
| LSFlocation not on record | 3 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 3 |
| Cascavel, BR | 3 |
| TAFORI-LSRClocation not on record | 3 |
| UEMAlocation not on record | 3 |
| Universidade Federal de Goiáslocation not on record | 3 |
| BRNUlocation not on record | 3 |
| GB | 3 |
| AUAlocation not on record | 3 |
| Instituto de Investigação Científica Tropicallocation not on record | 3 |
| LISClocation not on record | 3 |
| BMlocation not on record | 3 |
| Mlocation not on record | 3 |
| UNESP-RClocation not on record | 3 |
| BClocation not on record | 3 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 3 |
| Guasave, MX | 3 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 3 |
| Monastir, TN | 3 |
| NO DISPONIBLElocation not on record | 3 |
| Universidade de São Paulolocation not on record | 3 |
| Sangmiung Universitylocation not on record | 3 |
| Chapingo, MX | 3 |
| Foz do Iguaçu, BR | 3 |
| Departamento de Sistematica e Ecologialocation not on record | 3 |
| Clocation not on record | 3 |
| EAlocation not on record | 3 |
| CASlocation not on record | 3 |
| Shanghai, CN | 3 |
| National Natural History Collectionslocation not on record | 2 |
| Cambridge, US | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| UFERSAlocation not on record | 2 |
| HUAlocation not on record | 2 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 2 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| UEGlocation not on record | 2 |
| La Paz, MX | 2 |
| Université Nangui Abrogoualocation not on record | 2 |
| Arusha, TZ | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Montpellier, FR | 2 |
| IFANlocation not on record | 2 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 2 |
| Addis Ababa, ET | 2 |
| Calabar, NG | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| UFESlocation not on record | 2 |
| LNBG$location not on record | 2 |
| FJFClocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| National Museums of Kenyalocation not on record | 2 |
| Lanzhou, CN | 2 |
| ESALQlocation not on record | 2 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 2 |
| Campo Grande, BR | 2 |
| Universidad Nacional de Asunciónlocation not on record | 2 |
| UFPRlocation not on record | 2 |
| South China Normal Universitylocation not on record | 2 |
| Vancouver, CA | 2 |
| OTSlocation not on record | 2 |
| Culiacán, MX | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Shanghai, CN | 2 |
| Clemson, US | 2 |
| Kushiro City Museumlocation not on record | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| Njala Universitylocation not on record | 2 |
| Pennsylvania Department of Agriculturelocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 2 |
| Museo Athanasius Kircher di Romalocation not on record | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| Davis, US | 2 |
| arosemena tola, EC | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 2 |
| EFGlocation not on record | 2 |
| Philadelphia, US | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| Goucher Collegelocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Badajoz, ES | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Berea Collegelocation not on record | 1 |
| Llocation not on record | 1 |
| Minia, EG | 1 |
| Faculty of Applied Science, University of Sri Jayawardenepuralocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Capital Normal Universitylocation not on record | 1 |
| UFSCarlocation not on record | 1 |
| MUFALlocation not on record | 1 |
| UFPIlocation not on record | 1 |
| Kagoshima, JP | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Mexico City, MX | 1 |
| Oskarshamn, SE | 1 |
| Provo, US | 1 |
| Maringá, BR | 1 |
| Porto Velho, BR | 1 |
| Universidad Nacional del Litorallocation not on record | 1 |
| SCAUlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Managua, NI | 1 |
| Toluca, MX | 1 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 1 |
| San Diego, US | 1 |
| Buenos Aires, AR | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| PHlocation not on record | 1 |
| INMAlocation not on record | 1 |
| Toronto, CA | 1 |
| Tempe, US | 1 |
| Williamsburg, US | 1 |
| San Francisco de Campeche, MX | 1 |
| COLlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Zlocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Córdoba, AR | 1 |
| FPMZBlocation not on record | 1 |
| Dresden, DE | 1 |
| University of Oxfordlocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| Hermosillo, MX | 1 |
| NGCPR01018location not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Botanic Gardenlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Santa Maria, BR | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| GNWPlocation not on record | 1 |
| Stockholm, SE | 1 |
| Anchorage, US | 1 |
| Juriquilla, MX | 1 |
| Due West, US | 1 |
| Burlington, US | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| Knoxville, US | 1 |
| San Francisco, US | 1 |
| CPATSAlocation not on record | 1 |
| UEMlocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| VENlocation not on record | 1 |
| Haramaya Universitylocation not on record | 1 |
| Institut de Recherche pour le Developpement (IRD)location not on record | 1 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 1 |
| Guiyang, CN | 1 |
| Bogotá, D.C., CO | 1 |
| The Mauritius Herbariumlocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Zacatecas, MX | 1 |
| Long Beach, US | 1 |
| DSMlocation not on record | 1 |
| Puebla, MX | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
402 institutions · 9 924 of 10 860 vouchered records shown · 909 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA38 detections
Where the DNA of Fimbristylis dichotoma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found38
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 38 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.2 °C 12.6–21.0
Seasonal swing summer↔winter12.3 °C
Max temp (day)21.6 °C 16.4–25.9
Min temp (night)13.5 °C 7.40–16.1
Precipitation126 mm/mo 114–167
Air humidity61.4 % 58.2–61.5
Moisture balance39.0 mm/mo 9.90–52.1
Vapour deficit754 Pa 690–1,021
Wind speed4.00 m/s 2.90–4.70
Cloud cover35.6 % 35.6–41.1
CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.