Fimbristylis cymosa
R.Br. · speciesAt a glance
Occurrence records4 992
Data sources12
Biological traits30
DNA specimens3
eDNA detections3
Sources12 archives
Databases and archives Fimbristylis cymosa's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 992 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics3 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources30 traits
Occurrence & distributionGBIF4 992 records
Environmental DNA1 datasets · 1 countries3 detections
DNA & barcodingBOLD · NCBI3 specimens
Genome at a glanceCCDB · GIFT2n = 48
01Narrative
Fimbristylis cymosa, commonly known as tropical fimbry, or St. John's sedge, is a sedge of the family Cyperaceae that is native to Australia. The rhizomatous perennial grass-like or herb sedge typically grows to a height of 0.25 to. It blooms between February and September and produces brown flowers. In Western Australia it is found near the coast, on dunes and behind mangroves in the Kimberley region where it grows in sandy-clay alluvium around basalt or sandstone rocks.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology8
Fruit length max1 mm
Fruit length min0.7 mm
Leaf width max4 mm
Leaf width min1 mm
Plant height0.525 m
Plant height max0.8 m
Plant height min0.05 m
Seed mass0.086 mg
Life cycle & reproduction7
Dehiscenceindehiscent
Dispersal typeanimal
Flowering timenyyyyyyyynnn
Life formperennial
Life spanperennial
Raunkiær life formhemicryptophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica, Campo Limpo, Campo Rupestre, Palmeiral, Restinga, Vegetação Aquática
Mycorrhiza type0.02008568
Succulenceno
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC4
05DNA & barcoding3 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fimbristylis cymosa has left across the world's sequence archives.
At a glance
DNA specimens3
Marker genes4
GenBank sequences10
eDNA detections3
Countries3
The DNA barcodea real sequence read deposited for this species
TTGTTGCCTTTACGAAAATACGACCCGTGCACATGTAATGCAAAGCTGTTGAGGAGGAACGTTCTTCTCAGCCCAACCGGGCCTCGACCT …
Fimbristylis cymosa voucher 1155 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL1★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Fimbristylis cymosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Chromosome records10–962n range40median48mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 487×CCDB · cyper-only · CCDB · book-ipcn72 · CCDB · book-indian_vol2 +1
CCDB · cyper-only — Kral, R.1971
CCDB · cyper-only — Nijalingappa, B. H. M.1972
CCDB · cyper-only — 280Nijalingappa, B. H. M.1972
CCDB · cyper-only — Nijalingappa, B. H. M.1975a
CCDB · book-ipcn72 — NIJALINGAPPA, B.H.M. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-indian_vol2 — Kral, R. 1971 ; Nijalingappa, B.H.M. 1972, 1975a
GIFT · GIFT (floras)
2n 105×CCDB · cyper-only · CCDB · book-indian_vol2 · CCDB · eflora +1
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1974b
CCDB · book-indian_vol2 — Rath, S.P. & Patnaik, S.N. 1978b
CCDB · book-indian_vol2 — Rath, S.P. & Patnaik, S.N. 1974b
CCDB · eflora
GIFT · GIFT (floras)
2n 404×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · cyper-only — 280Nijalingappa, B. H. M.1975a
CCDB · ipcn-api-dl — Nijalingappa, B. H. M. 1975. Cytological studies in Fimbristylis (Cyperaceae). Cytologia 40: 177–183.
CCDB · book-ipcn75-78 — Nijalingappa 1975
GIFT · GIFT (floras)
2n 323×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · eflora
CCDB · cyper-only — 283Subramanian, D.1988
CCDB · ipcn-api-dl — Subramanian, D. 1988. Cytotaxonomical studies in south Indian Cyperaceae I. Species from the plains. Cytologia 53: 67–72.
CCDB · eflora
2n 962×CCDB · cyper-only
CCDB · cyper-only — 282Mehra, P. N. & S. K. Sachdeva1971
CCDB · cyper-only — 282Mehra, P. N. & S. K. Sachdeva1975b
2n 221×CCDB · cyper-only
CCDB · cyper-only — 282Subramanian, D.1988
2n 281×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 521×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Yano. 2006. Phylogenetic relationships and chromosome evolution of Japanese Fimbristylis (Cyperaceae) using nrDNA ITS and ETS 1f sequence data. Acta Phytotax. Geobot. 57: 205–217.
2n 561×CCDB · eflora
CCDB · eflora
n 54×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74
CCDB · cyper-only — 280Rath, S. P. & S. N. Patnaik1974b
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978b
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1978. Cytological studies in Cyperaceae. Proc. Indian Sci. Congr. Assoc. (III, C) 65: 107–108.
CCDB · book-ipcn73-74 — RATH, S.P., & S.N. PATNAIK. 1974. Cytological studies in Cyperaceae with special reference to its taxonomy I. Cytologia 39: 341-352.
n 483×CCDB · cyper-only
CCDB · cyper-only — 281Mehra, P. N. & S. K. Sachdeva.1971
CCDB · cyper-only — 281Mehra, P. N. & S. K. Sachdeva1975b
CCDB · cyper-only — 282Bir, S. S., P. Cheema & M. K. Sidhu1990
n 242×CCDB · cyper-only · CCDB · book-ipcn67-71
CCDB · cyper-only — 280Kral, R.1971
CCDB · book-ipcn67-71 — KRAL, R. 1971. A treatment of Abildgardia, Bulbostylis, and Fimbristylis for North America. Sida 4: 57-227.
n 492×CCDB · cyper-only
CCDB · cyper-only — 282Bir, S. S., M. K. Sidhu & S. Kamra1981
CCDB · cyper-only — 282Bir, S. S., S. Kamra, M. K. Sidhu & P. Cheema1988b
n 441×CCDB · cyper-only
CCDB · cyper-only — 282Bir, S. S., P. Cheema & M. K. Sidhu1988a
08Occurrence & distribution
Record type4 992 records
Wild obs. + sensor2 237
Museum / vouchered2 682
Other73
Origin
Native458
Range
Area of Occupancy AOO10 804 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy70% within 1 km
≤100 m 1 061≤1 km 193≤10 km 374>10 km 158
1 786 georeferenced · 451 without coordinates
Open the mapobservation + sensor2 237
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy65% within 1 km
≤100 m 279≤1 km 49≤10 km 153>10 km 27
508 georeferenced · 2 174 without coordinates
Open the institutions mapphysical evidence2 682
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions98 of 202 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 223 |
| Bronx, US | 144 |
| Durango, MX | 126 |
| Kew, GB | 81 |
| University of Stellenboschlocation not on record | 75 |
| Masindi, UG | 65 |
| Palmerston, AU | 62 |
| Tampa, US | 62 |
| Mexico City, MX | 61 |
| Brisbane, AU | 56 |
| Universidade Federal de Sergipe (UFS)location not on record | 54 |
| Salvador, BR | 54 |
| Paris, FR | 51 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 42 |
| Kensington, AU | 39 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 36 |
| Mount Annan, AU | 34 |
| TAIElocation not on record | 34 |
| UNIVASFlocation not on record | 31 |
| Université de Bordeauxlocation not on record | 31 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 30 |
| Altos de Pipe, VE | 30 |
| National Biodiversity Institute, Costa Ricalocation not on record | 29 |
| Canberra, AU | 29 |
| Mérida, MX | 28 |
| UFPElocation not on record | 27 |
| UFERSAlocation not on record | 27 |
| UFBAlocation not on record | 27 |
| Departamento de Sistematica e Ecologialocation not on record | 26 |
| Chaguaramas, TT | 25 |
| Pretoria, ZA | 24 |
| Universidade Federal do Maranhãolocation not on record | 22 |
| Honolulu, US | 22 |
| St. Augustine, TT | 21 |
| Taipei, TW | 21 |
| JBRJlocation not on record | 20 |
| MeiseBGlocation not on record | 18 |
| Jena Microbial Resource Collectionlocation not on record | 17 |
| UFSClocation not on record | 15 |
| Université de Strasbourglocation not on record | 15 |
| Taipei, TW | 15 |
| Universidade Federal de Santa Catarinalocation not on record | 14 |
| Auckland, NZ | 14 |
| IECOSlocation not on record | 13 |
| UFESlocation not on record | 13 |
| Federal University of Espírito Santolocation not on record | 13 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 13 |
| Universidade Federal do Vale do São Franciscolocation not on record | 13 |
| Taipei, TW | 12 |
| LBVlocation not on record | 12 |
| Plocation not on record | 12 |
| BISHlocation not on record | 12 |
| Tapachula, MX | 12 |
| Laboratorio de Ictiologialocation not on record | 12 |
| Conservatoire Botanique National de Mascarinlocation not on record | 11 |
| UnBlocation not on record | 10 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 10 |
| Armidale, AU | 10 |
| Fortaleza, BR | 9 |
| Museo Entomologico de Leonlocation not on record | 9 |
| MAlocation not on record | 9 |
| Xiamen, CN | 9 |
| San Francisco de Campeche, MX | 8 |
| Universidad Nacional de Colombia (UNAL)location not on record | 8 |
| UFRPElocation not on record | 8 |
| CEPLAClocation not on record | 8 |
| Fort Worth, US | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Museu Paraense Emílio Goeldilocation not on record | 8 |
| Miami, US | 7 |
| Smithfield, AU | 7 |
| Herbier National du Gabonlocation not on record | 7 |
| Moscow State Universitylocation not on record | 6 |
| South Kensington, GB | 6 |
| Porto Alegre, BR | 6 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 6 |
| WAGlocation not on record | 6 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 5 |
| Christchurch, NZ | 5 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 5 |
| Jackson, US | 5 |
| USP-IBlocation not on record | 4 |
| Brasília, BR | 4 |
| EL PASO, US | 4 |
| Universidad Nacional Agrarialocation not on record | 4 |
| Vancouver, CA | 4 |
| LSF/FSA/UAClocation not on record | 4 |
| Cenargenlocation not on record | 4 |
| Blumenau, BR | 4 |
| Glocation not on record | 4 |
| Berlin, DE | 4 |
| UEMAlocation not on record | 4 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 4 |
| CPATSAlocation not on record | 4 |
| Chicago, US | 3 |
| León, NI | 3 |
| San José, CR | 3 |
| Frankfurt am Main | 3 |
| Ann Arbor, US | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Cruz das Almas, BR | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| Dekalb, US | 3 |
| Pondicherry, IN | 3 |
| Ciudad de México, MX | 3 |
| Feira de Santana, BR | 3 |
| Austin, US | 2 |
| Cascavel, BR | 2 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Seychelles National Herbariumlocation not on record | 2 |
| UEPAlocation not on record | 2 |
| Toronto, CA | 2 |
| Chapingo, MX | 2 |
| Provo, US | 2 |
| HNBlocation not on record | 2 |
| Maringá, BR | 2 |
| Claremont, US | 2 |
| Elocation not on record | 2 |
| Olocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Ivano-Frankivsk, UA | 2 |
| Adelaide, AU | 2 |
| BMlocation not on record | 2 |
| Calabar, NG | 2 |
| Burlington, US | 2 |
| UESBlocation not on record | 2 |
| Valdosta State Universitylocation not on record | 2 |
| Brasília, BR | 2 |
| Aarhus, DK | 2 |
| Clocation not on record | 2 |
| Cambridge, US | 2 |
| Austin, US | 2 |
| Odawara, JP | 2 |
| Millersville, US | 2 |
| Columbia, US | 2 |
| GAlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| ASUlocation not on record | 1 |
| Managua, NI | 1 |
| PHlocation not on record | 1 |
| Centro de Biotecnologia e Quimica-CEBIQlocation not on record | 1 |
| Moscow, US | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Madison, US | 1 |
| Bando, JP | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| UFAClocation not on record | 1 |
| Londrina, BR | 1 |
| TNMlocation not on record | 1 |
| Ilhéus, BR | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Hobart, AU | 1 |
| UFMGlocation not on record | 1 |
| Whitehorse, CA | 1 |
| GB | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| Department of Earth and Environmental Sciences, Yarmouk Universitylocation not on record | 1 |
| Teresina, BR | 1 |
| Toyama, JP | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| San Angelo, US | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Centre D'Etude sur les Ressources Végétaleslocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Chadron, US | 1 |
| Wellington, NZ | 1 |
| Botanical Garden "Anastasie Fatu" of Iasilocation not on record | 1 |
| Riverside, US | 1 |
| Kagoshima, JP | 1 |
| US | 1 |
| DSMlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Instituto de Investigação Científica Tropicallocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 1 |
| Durham, US | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Salem Collegelocation not on record | 1 |
| Universidad Pablo de Olavidelocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Wlocation not on record | 1 |
| Sanda, JP | 1 |
| Durban, ZA | 1 |
| CJBGlocation not on record | 1 |
| LUAlocation not on record | 1 |
| Ixtacuixtla de Mariano Matamoros, MX | 1 |
| Flagstaff, US | 1 |
| James Cook Townsvillelocation not on record | 1 |
| Museum of Zoologylocation not on record | 1 |
| Davis, US | 1 |
| BRLUlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Montpellier, FR | 1 |
| Mexico City, MX | 1 |
| Edinburgh, GB | 1 |
| Stockholm, SE | 1 |
202 institutions · 2 432 of 2 682 vouchered records shown · 249 without an institution code
09Environmental DNA3 detections
Where the DNA of Fimbristylis cymosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median7.40 °C 7.40–7.40
Seasonal swing summer↔winter25.4 °C
Max temp (day)9.60 °C
Min temp (night)3.00 °C
Precipitation344 mm/mo
Air humidity64.9 %
Moisture balance263 mm/mo
Vapour deficit428 Pa
Wind speed2.90 m/s
Cloud cover44.6 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.