Fimbristylis cinnamometorum

(Vahl) Kunth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Fimbristylis

At a glance

Occurrence records1 048

Data sources8

Biological traits30

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Fimbristylis cinnamometorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 048 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF1 048 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 10

01Narrative

Fimbristylis cinnamometorum là loài thực vật có hoa trong họ Cói. Loài này được (Vahl) Kunth mô tả khoa học đầu tiên năm 1837.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length0.8 mm

Fruit width0.55 mm

Leaf length max1 mm

Leaf length min0.5 mm

Leaf width0.4 mm

Leaf width max1 mm

Leaf width min0.5 mm

Plant height0.5 m

Plant height max0.6 m

Plant height min0 m

Seed mass0.161 mg

Life cycle & reproduction7

Dehiscenceindehiscent

Flowering timeyynnnnnnyyyy

Life formannual or perennial

Life spanperennial

Lifeform raunkiaer detailedhemicryptophyte

Resprouting capacityfire_killed resprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fimbristylis cinnamometorum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ307383.1 ↗615 bpChina · 2021

ACGT

TGTTGCCTTTACAAAACACGACATGTGCACATGTAATGCAAAGCTGCTGAGGGGGAACGTTCTCCCCAGCCCAACCGGTCTCAACTTTTT …

Fimbristylis cinnamometorum voucher 1181a internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Fimbristylis cinnamometorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–102n range10median10mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 106×CCDB · cyper-only · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2

CCDB · cyper-only — Nijalingappa, B. H. M.1972

CCDB · cyper-only — Nijalingappa, B. H. M.1975a

CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978a

CCDB · book-ipcn75-78 — Nijalingappa 1975

CCDB · book-indian_vol2 — Nijalingappa, B .H. M. 1972, 1975a ; Rath, S.P. & Patnaik, S.N. 1978a

CCDB · book-indian_vol2 — Rath, S.P. & Patnaik, S.N. 1975

n 52×CCDB · cyper-only · CCDB · book-ipcn75-78

CCDB · cyper-only — 279Rath, S. P. & S. N. Patnaik1975

CCDB · book-ipcn75-78 — Rath & Patnaik 1975

08Occurrence & distribution

Record type1 048 records

Wild obs. + sensor428

Museum / vouchered472

Other148

Origin

Native83

Range

Area of Occupancy AOO3 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 286≤1 km 5≤10 km 3>10 km 5

299 georeferenced · 129 without coordinates

Open the mapobservation + sensor428

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 108≤1 km 30≤10 km 179>10 km 54

371 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence472

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	131
Palmerston, AU	92
Mount Annan, AU	75
Museo Entomologico de Leonlocation not on record	27
Kew, GB	26
Kensington, AU	21
Smithfield, AU	21
Armidale, AU	20
Canberra, AU	17
Christchurch, NZ	4
James Cook Townsvillelocation not on record	3
Bronx, US	2
Guangzhou, CN	2
Beijing, CN	1
Dresden, DE	1
Xiamen, CN	1
John T. Waterhouse Herbariumlocation not on record	1
Hobart, AU	1
Auckland, NZ	1
Honolulu, US	1

20 institutions · 448 of 472 vouchered records shown · 24 without an institution code

09Environmental DNA1 detections

Where the DNA of Fimbristylis cinnamometorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Fimbristylis cinnamometorum

At a glance

Sources8 archives

Size & morphology11

Life cycle & reproduction7

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 048 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 048 records