Filipendula vulgaris
Moench · speciesAt a glance
Occurrence records148 014
Data sources13
Biological traits52
DNA specimens33
eDNA detections31
Sources13 archives
Databases and archives Filipendula vulgaris's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility148 014 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources52 traits
Chemical compositionLOTUS2 compounds
Occurrence & distributionGBIF148 014 records
Environmental DNA4 datasets · 7 countries31 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceCCDB · GoaT401 Mbp
01Narrative
Illustration showing tubers. Filipendula vulgaris, commonly known as dropwort or fern-leaf dropwort, is a perennial herbaceous plant in the family Rosaceae, closely related to meadowsweet (Filipendula ulmaria). It is found in dry pastures across much of Europe and central and northern Asia, mostly on lime. The crushed leaves and roots have a scent of the oil of wintergreen (methyl salicylate).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology15
Fruit length4 mm
Leaf length max135 mm
Leaf mass142 mg
Leaf size3 520 mm²
Leaf width30 mm
Leaf width max30 mm
Leaf width min30 mm
Plant height0.325 m
⚠ sources differ — GIFT: 0.325 m · LEDA: 0.35 m · TRY: 0.284 m
Plant height generative0.414 m
Plant height max0.8 m
Plant height min0.3 m
Seed length3.5 mm
Seed mass0.85 mg
⚠ sources differ — TRY: 0.85 mg · LEDA: 0.771 mg · GIFT: 0.811 mg
Seed mass max1.31 mg
Seed mass min0.518 mg
Life cycle & reproduction15
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endJul
Flowering startJun
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals < 5 years (short-lived perennials) · GIFT: perennial
Lifespan years4 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number416
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTcut-over forest, forest, forest edges, meadows: dry, shrubberies, steppe
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio23.15 g/g
Leaf c480 mg/g
Leaf dry-matter content (LDMC)217 mg/g
⚠ sources differ — TRY: 217 mg/g · LEDA: 295 mg/g
Leaf n19.87 mg/g
Leaf p1.9 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)20.62 mm²/mg
⚠ sources differ — TRY: 20.62 mm²/mg · LEDA: 17.89 mm²/mg · GIFT: 18.39 mm²/mg
Other traits3
Diaspore typeone-seeded generative dispersule
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition2 compounds
Compounds documented for Filipendula vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Flavonols2
Documented compounds2 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Npc139381 | present | LOTUS | |
| Quercetin 4'-glucoside | present | LOTUS |
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Filipendula vulgaris has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes8
GenBank sequences9
eDNA detections31
Countries7
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCAGAGGGCACGCCTGCCTGGGCGTCACATGTCGTTGCCCCACC …
Filipendula vulgaris voucher PLT.0294a 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL2★rbcLa★trnL-F★ITS4★ITS1★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Filipendula vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size400 980 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Filipendula vulgaris0.40 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–162n range14median14mode34records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1432×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · brit-fl — Baker, H.G., Baker, I. Amer. J. Bot. 54: 1027-1034 (1967)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · fl-europaea — Polya, 1950
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · ipcn-api-dl — Lempi;auainen, T. 1982. Morphological and chemical variation among Eurasian populations of Filipendula vulgaris. (Rosaceae). Ann. Bot. Fenn. 19: 127–146.
CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Baltisberger, M. 1987. Chromosomenzahlen einiger Pflanzen aus Albanien. Ber. Geobot. Inst. ETH Stiftung Rübel 53: 47–63.
CCDB · ipcn-api-dl — Pogan, E., H. Wcislow & A. Jankun. 1980. Further studies in chromosome numbers of Polish Angiosperms Part XlIl. Acta Biol. Cracov., Ser. Bot. 22: 37–69.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn75-78 — Natarajan 1978
CCDB · book-ipcn75-78 — Lempiainen 1978
CCDB · book-ipcn75-78 — Natarajan 1977
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-atlas-flowering-plants — Wulff 1938
CCDB · kew — Pustahija F, Brown SC, Bogunic F, Bašic N, Muratovic E, Ollier S, Hidalgo O, Bourge M, Stevanovic V, Sijak-Yakovev S. 2013. Small genomes dominate in plants growing on serpentine soils in West Balkans, an exhaustive study of 8 habitats covering 308 taxa.
CCDB · CromoCat 2015 — Baker, H. G. & Baker, I. (1967). The cytotaxonomy of Filipendula (Rosaceae) and its implications. Amer. J. Bot. 54: 1027-1034.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Lempiäinen, T. (1978). The effect of cultivation and fertilizers on Filipendula vulgaris Moench, especially on its tuberous roots. Acta Bot. Fenn. 107: 1-22.
CCDB · CromoCat 2015 — Loon van, J. C. & van Setten, A. K. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 589-592.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974a). Cytotaxonomy of Spanish plants III. Dycotiledons: Salicaceae-Rosaceae. Lagascalia 4(1): 3-32.
CCDB · CromoCat 2015 — Malakhova, L. A. (1990). Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh restenij na juge Tomskoj Oblasti. Bull. Glavn. Bot. Sada 155: 60-66.
CCDB · CromoCat 2015 — Pólya, L. (1950). Magyarországi növényfajok kromoszómaszámai. II. Ann. Biol. Univ. Decebren. 1: 46-56.
CCDB · CromoCat 2015 — Uhríková, A. & A. Murín. (1970). Reports (In Májovsky, J. & al. (ed.), Index of chromosome numbers of slovakian flora. Part 2). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 18: 45-60.
CCDB · CromoCat 2015 — Wulff, H. D. (1938). Chromosomenstudien an der schleswig-holsteinischen Angiospermen-Flora. II. Ber. Deutsch. Bot. Ges. 56: 247-254.
CCDB · CromoCat 2015 — Natarajan, G. (1978b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 526-531.
2n 154×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · CromoCat 2015
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · CromoCat 2015 — Maude, P. F. (1939). The Merton catalogue. A list of the chromosome numerals of species of British flowering plants. New Phytol. 38: 1-31.
CCDB · CromoCat 2015 — Maude, P. F. (1940). Chromosome numbers in some British plants. New Phytol. 39: 17-32.
2n 162×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Lovkvist, 1963
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 76×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 342-348. Ubera, J. L. & E. Ruz de Clavijo Jimnez.Lagascalia12(2): 294-296(1984).
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Ubera, J. L. & E. R. Clavijo. 1984. Números 342-348, In Números cromosómicos para la flora española. 300-364. Lagascalia 12: 294–296.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Baker, H. G. & Baker, I. (1967). The cytotaxonomy of Filipendula (Rosaceae) and its implications. Amer. J. Bot. 54: 1027-1034.
CCDB · CromoCat 2015 — Ubera, J. L. & E. Ruíz de Clavijo Jiménez. (1984). Números cromosómicos para la flora española, 342-348. Lagascalia 12(2): 294-296.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type148 014 records
Wild obs. + sensor140 505
Museum / vouchered6 576
Cultivated / captive27
Fossil1
Other905
Origin
Native4 548
Introduced301
Range
Area of Occupancy AOO183 396 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy66% within 1 km
≤100 m 51 682≤1 km 15 662≤10 km 33 436>10 km 1 262
102 042 georeferenced · 38 463 without coordinates
Open the mapobservation + sensor140 505
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 559≤1 km 1 359≤10 km 1 973>10 km 586
4 477 georeferenced · 2 099 without coordinates
Open the institutions mapphysical evidence6 576
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy10% within 1 km
≤100 m 1≤1 km 1≤10 km 5>10 km 14
21 georeferenced · 6 without coordinates
Open the mapnot free-living27
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions76 of 163 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 342 |
| Moscow State Universitylocation not on record | 570 |
| Helsinki, FI | 440 |
| LDlocation not on record | 308 |
| BIO-UNIPIlocation not on record | 254 |
| Turku, FI | 248 |
| Olocation not on record | 187 |
| Oskarshamn, SE | 139 |
| BFLlocation not on record | 139 |
| SLU Artdatabankenlocation not on record | 132 |
| BRNUlocation not on record | 107 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 95 |
| València, ES | 83 |
| MAlocation not on record | 81 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 78 |
| Berlin, DE | 69 |
| TUR-Alocation not on record | 68 |
| Oulu, FI | 66 |
| Zürich, CH | 63 |
| Zürich, CH | 57 |
| Philadelphia, US | 54 |
| Salzburg, AT | 53 |
| Entomological Society of Latvialocation not on record | 52 |
| Wlocation not on record | 51 |
| GJOlocation not on record | 48 |
| MeiseBGlocation not on record | 48 |
| BDBClocation not on record | 47 |
| Barcelona, ES | 46 |
| Trondheim, NO | 39 |
| Bern, CH | 37 |
| South Kensington, GB | 35 |
| Jyväskylä, FI | 33 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 32 |
| San Sebastián, ES | 30 |
| Tallinn, EE | 28 |
| Tartu, EE | 28 |
| BClocation not on record | 28 |
| No collectionlocation not on record | 27 |
| Salamanca, ES | 26 |
| Kuopio, FI | 26 |
| Mlocation not on record | 24 |
| Madrid, ES | 24 |
| Vitoria, ES | 23 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 21 |
| Bergen, NO | 21 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 20 |
| Görlitz, DE | 18 |
| KMNlocation not on record | 18 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| Pamplona, ES | 14 |
| SWlocation not on record | 14 |
| Provincia di Livornolocation not on record | 13 |
| College of the Atlantic, Museumlocation not on record | 13 |
| LfUlocation not on record | 12 |
| Porvoo, FI | 12 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 11 |
| Stockholm, SE | 10 |
| Xiamen, CN | 10 |
| TROMlocation not on record | 10 |
| CJBGlocation not on record | 9 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 9 |
| DBF-NHMDlocation not on record | 9 |
| Tula State Universitylocation not on record | 9 |
| Uniwersytet Jagiellońskilocation not on record | 8 |
| Granada, ES | 7 |
| Christchurch, NZ | 7 |
| CICYTEXlocation not on record | 7 |
| Uppsala, SE | 7 |
| Durham, US | 7 |
| Denver, US | 6 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 6 |
| Bourges, FR | 6 |
| PRClocation not on record | 6 |
| Frankfurt am Main | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| OLAlocation not on record | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| Pamplona, ES | 6 |
| Canberra, AU | 6 |
| Gijón, ES | 5 |
| BSBIlocation not on record | 5 |
| ISAlocation not on record | 5 |
| Karlsruhe, DE | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Frauenfeld, CH | 5 |
| Badajoz, ES | 5 |
| H-Adlerlocation not on record | 4 |
| UniKSlocation not on record | 4 |
| Samara National Research Universitylocation not on record | 4 |
| Urumqi, CN | 4 |
| Alicante, ES | 4 |
| Uniwersytet Warszawskilocation not on record | 4 |
| Porrentruy, CH | 4 |
| Jaén, ES | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| nbflocation not on record | 3 |
| Taipei, TW | 3 |
| Santiago de Compostela, ES | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Saint Louis, US | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Auckland, NZ | 3 |
| Paris, FR | 2 |
| Dekalb, US | 2 |
| Sion, CH | 2 |
| Hobart, AU | 2 |
| Columbia, US | 2 |
| Kew, GB | 2 |
| Victoria, CA | 2 |
| WTUlocation not on record | 2 |
| San Jose, US | 2 |
| Tromso University Museumlocation not on record | 2 |
| CZE061location not on record | 2 |
| Coimbra, PT | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| GZUlocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Bloomington, US | 2 |
| Voronezh State Universitylocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| CIBIOlocation not on record | 1 |
| Dresden, DE | 1 |
| H-AkrKGlocation not on record | 1 |
| Beijing, CN | 1 |
| BioFokuslocation not on record | 1 |
| Banyoles, ES | 1 |
| Tuscaloosa, US | 1 |
| NoColllocation not on record | 1 |
| Bronx, US | 1 |
| NMBU:MINAlocation not on record | 1 |
| Rovaniemi, FI | 1 |
| JBAlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| FLADlocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| H-Starnlocation not on record | 1 |
| Boumlocation not on record | 1 |
| Vancouver, CA | 1 |
| Whitehorse, CA | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Macomb, US | 1 |
| München, DE | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Göteborg, SE | 1 |
| Forssa, FI | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Rotorua, NZ | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| JBCLMlocation not on record | 1 |
| Lausanne, CH | 1 |
| ULBF-AGRlocation not on record | 1 |
| Corvallis, US | 1 |
| Edinburgh, GB | 1 |
| SZUlocation not on record | 1 |
| Burlington, US | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
163 institutions · 5 914 of 6 576 vouchered records shown · 659 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA31 detections
Where the DNA of Filipendula vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys4
Countries7
Verifiable raw sequence linked3
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map7 countries0
heath
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.8 °C 11.4–16.7
Seasonal swing summer↔winter20.8 °C
Max temp (day)17.2 °C 14.2–20.2
Min temp (night)10.8 °C 8.80–14.0
Precipitation72.3 mm/mo 57.2–91.3
Air humidity62.3 % 57.7–64.8
Moisture balance-28.0 mm/mo -64.1–22.4
Vapour deficit637 Pa 486–794
Wind speed3.80 m/s 2.80–7.10
Cloud cover43.6 % 40.5–51.7
CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.