Filipendula rubra

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Filipendula

At a glance

Occurrence records1 637

Data sources9

Biological traits11

DNA specimens5

eDNA detections3

Sources9 archives

Databases and archives Filipendula rubra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 637 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF1 637 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Filipendula rubra, also known as queen-of-the-prairie, is a species of flowering plant in the family Rosaceae native to the northeastern and central United States and southeastern Canada. It prefers full sun or partial shade and moist soil, but tolerates drier soil in a shadier location. It grows tall and firm, and produces blooms that are tiny and pink above its ferny, pointy leaves.Explore Cornell - Home Gardening - Flower Growing Guides - Growing Guide." Explore Cornell - Home Gardening - Flower Growing Guides. N.p., 2006. Web. 23 Oct. 2013. Of the numerous garden cultivars, 'Venusta' has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Filipendula rubra has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMK525855.1 ↗549 bp

ACGT

AAAGCAAGTGTTGGATTCAAAGCGGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTG …

Filipendula rubra ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK5rbcL5ITSITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 637 records

Wild obs. + sensor1 360

Museum / vouchered275

Cultivated / captive2

Range

Area of Occupancy AOO4 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 661≤1 km 109≤10 km 32>10 km 382

1 184 georeferenced · 176 without coordinates

Open the mapobservation + sensor1 360

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 28≤1 km 73≤10 km 79>10 km 11

191 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence275

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	60
Bloomington, US	37
Philadelphia, US	25
Burlington, US	16
Madison, US	9
Saint Louis, US	8
New Haven, US	7
Bangkok, TH	7
SLU Artdatabankenlocation not on record	7
Québec, CA	5
DULlocation not on record	5
University of New Hampshirelocation not on record	4
Bronx, US	4
Toronto, CA	4
Wuzhou, CN	4
Université Lavallocation not on record	3
Saint John, CA	3
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	3
Tampa, US	3
St. Paul, US	3
LDlocation not on record	3
University of Stellenboschlocation not on record	3
Philadelphia, US	3
Oskarshamn, SE	2
Christchurch, NZ	2
Oulu, FI	2
KMNlocation not on record	2
Bern, CH	2
Hobart, AU	2
Karlsruhe, DE	2
Denver, US	2
Acadia Universitylocation not on record	2
Green Bay, US	2
Davenport, US	1
Whitewater, US	1
Ann Arbor, US	1
Staten Island, US	1
Dekalb, US	1
Logan, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Elikins, US	1
McWane Science Centerlocation not on record	1
Olocation not on record	1
Norfolk, US	1
Chicago, US	1

45 institutions · 258 of 275 vouchered records shown · 17 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Filipendula rubra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Damp, sedgy area, now drying up, next to mow…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 18.6–18.6

Seasonal swing summer↔winter29.9 °C

Max temp (day)23.3 °C

Min temp (night)14.9 °C 14.6–15.2

Precipitation106 mm/mo 96.0–116

Air humidity60.4 % 60.3–60.4

Moisture balance-19.4 mm/mo -37.1–-1.80

Vapour deficit848 Pa 843–853

Wind speed2.50 m/s 2.30–2.60

Cloud cover45.6 % 41.6–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources9 archives

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

At a glance

Record type1 637 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions32 of 45 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 637 records