Filipendula multijuga

Maxim. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Filipendula

At a glance

Occurrence records399

Data sources9

Biological traits4

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Filipendula multijuga's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility399 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF399 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Filipendula multijuga is a species of plant in the family Rosaceae that is native to Japan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formperennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Filipendula multijuga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Simple phenolic acids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Methyl salicylate		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Filipendula multijuga has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSKU294754.1 ↗612 bp

ACGT

AACTAGTTTCAACGCTTGGGGGCGAAGGGCCTTGTGCCCGTCGTTCCCTTTTCTCGAGGGGCGAGCGTTGTGTGTGTGTCCTTACCGTTC …

Filipendula multijuga var. ciliata isolate FMC2i internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type399 records

Wild obs. + sensor27

Museum / vouchered366

Cultivated / captive6

Range

Area of Occupancy AOO876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 2≤1 km 5≤10 km 2>10 km 3

12 georeferenced · 15 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 1≤1 km 7≤10 km 86

94 georeferenced · 272 without coordinates

Open the institutions mapphysical evidence366

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 1 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Shinshu Universitylocation not on record	83
Odawara, JP	54
Toyama, JP	45
Nagano City, JP	38
Sendai, JP	37
KOMlocation not on record	21
Sanda, JP	18
Nagatoro-machi, Chichibu-gun, JP	18
Kochi, JP	13
Tokushima, JP	8
Bando, JP	6
FFPRIlocation not on record	4
Chiba, JP	3
Universidad Católica de Santa Maríalocation not on record	3
Burlington, US	3
Fukushima Universitylocation not on record	1
Vancouver, CA	1
Otaru, JP	1
JP	1
J.F.Oberlin Universitylocation not on record	1
KIRMlocation not on record	1
Tomioka, JP	1
Museum Of Natural And Environmental History, Shizuokalocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
SLU Artdatabankenlocation not on record	1
Fort Worth, US	1

26 institutions · 365 of 366 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Filipendula multijuga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)