Filifolium sibiricum

(L.) Kitam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Filifolium

At a glance

Occurrence records955

Data sources9

Biological traits30

DNA specimens0

eDNA detections2

Sources9 archives

Databases and archives Filifolium sibiricum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility955 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources30 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF955 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Filifolium is a genus of flowering plants in the daisy family.Kitamura, Siro. 1940. Acta Phytotaxonomica et Geobotanica 9: 157Tropicos, Filifolium Kitam.Flora of China Vol. 20-21 Page 747 线叶菊属 xian ye ju shu Filifolium Kitamura, Acta Phytotax. Geobot. 9: 157. 1940. There is only one known species, Filifolium sibiricum, native to Japan, Korea, Mongolia, China (Manchuria, Inner Mongolia, Hebei, Shanxi) and parts of Asiatic Russia (Primorye, Amur, Khabarovsk, Irkutsk, Zabaykalsky Krai, Buryatiya).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology8

Leaf length200 mm

Leaf size13 mm²

Leaf width55 mm

Leaf width max60 mm

Leaf width min50 mm

Plant height0.15 m

Plant height max0.6 m

Plant height min0.2 m

Life cycle & reproduction6

DeciduousnessN

Dispersal typewind

Flowering endSep

Flowering startJul

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains, steppe, stony places

Leaf formlinear

Woodinessnon-woody

Physiology & chemistry5

Leaf c435 mg/g

Leaf n17.46 mg/g

Leaf p0.92 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)4.88 mm²/mg

Other traits3

Leaf marginentire

Leaf spinesno

Leaf thornsno

03Chemical composition10 compounds

Compounds documented for Filifolium sibiricum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavanones10

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-2-(2,5-dihydroxyphenyl)-5,7-dihydroxy-2,3-dihydrochromen-4-one	present	LOTUS
(2R)-2-(2,5-dihydroxyphenyl)-5,7-dihydroxy-6-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2R)-5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
(2s)-5,7,2',5'-Tetrahydroxy-6-methoxyflavanone	present	LOTUS
(2s)-5,7,2',5'-Tetrahydroxyflavanone	present	LOTUS
(2S)-5-hydroxy-2-(4-hydroxyphenyl)-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	LOTUS
(R)-naringenin	present	LOTUS
6-Methoxynaringenin	present	LOTUS
Homoeriodictyol	present	LOTUS
Isosakuranetin	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Filifolium sibiricum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFJ643042.1 ↗219 bp

ACGT

ATCGCGTCGCCCCCCACAATTCTCCGCAAAGGGAACTTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAA …

Filifolium sibiricum internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Filifolium sibiricum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records16–182n range18median18mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 189×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-fedorov +1

CCDB · iapt — IAPT/IOPB Chromosome Data 10

CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1985. Chromosome numbers in some species of the family Asteraceae from the southernpart of the Soviet Far East. Bot. Zhurn. SSSR 70(7): 1000–1001. (In Russian).

CCDB · ipcn-api-dl — Mĕsíček, J. & J. Soják. 1992. Chromosome numbers of Mongolian angiosperms. I. Preslia 64: 193–206.

CCDB · ipcn-api-dl — Starodubtsev, V. N. 1997. Chromosome numbers in some rare species of vascular plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 82(5): 121–122.

CCDB · ipcn-api-dl — Valles, J. 2005. Chromosome numbers in the tribes Anthemideae and Inuleae (Asteraceae). Bot. J. Linn. Soc. 148: 77–85.

CCDB · ipcn-api-dl — Probatova, N. S. 2000. Chromosome numbers in some plant species from the Razdolnaya (Suifun) river basin (Primorsky Territory). Bot. Žhurn. (Moscow & Leningrad) 85(12): 102–107.

CCDB · book-fedorov — UyKCaHOBa HeOny6JI.

CCDB · kew — Garcia S, Sanz M, Garnatje T et al. 2004. Variation of DNA amount in 47 populations of the subtribe Artemisiinae and related taxa (Asteraceae, Anthemideae): karyological, ecological, and systematic implications. Genome 47: 1004-1014.

CCDB · iapt — IAPT/IOPB Chromosome Data 20

2n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.

08Occurrence & distribution

Record type955 records

Wild obs. + sensor384

Museum / vouchered569

Other2

Range

Area of Occupancy AOO2 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 133≤1 km 29≤10 km 18>10 km 99

279 georeferenced · 105 without coordinates

Open the mapobservation + sensor384

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 1≤1 km 5≤10 km 179>10 km 5

190 georeferenced · 379 without coordinates

Open the institutions mapphysical evidence569

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	138
Institute of Applied Ecology, Academia Sinicalocation not on record	76
Moscow State Universitylocation not on record	66
ENTClocation not on record	18
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	11
Xining, CN	11
Peking Universitylocation not on record	10
Kunming, CN	10
Inner Mongolia Universitylocation not on record	10
Guilin, CN	9
Shanxi Institute of Biologylocation not on record	6
SXTCMlocation not on record	6
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	4
Nanjing, CN	4
Jiangxi College of Educationlocation not on record	3
National Institute of Biological Resourceslocation not on record	2
Wuhan, CN	2
IMMUlocation not on record	2
SCAUlocation not on record	2
Northeastern Forestry Universitylocation not on record	2
IWEP FEB RASlocation not on record	2
Stockholm, SE	1
KR	1
Zhejiang Universitylocation not on record	1
Lanzhou, CN	1
Beijing Normal Universitylocation not on record	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	1
Guangzhou, CN	1
Guangzhou, CN	1
Kyoto Universitylocation not on record	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1
Nanjing, CN	1
Shanghai, CN	1

34 institutions · 407 of 569 vouchered records shown · 162 without an institution code

09Environmental DNA2 detections

Where the DNA of Filifolium sibiricum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)