Filicium decipiens

(Wight & Arn.) Thwaites · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Filicium

At a glance

Occurrence records819

Data sources13

Biological traits22

DNA specimens10

eDNA detections8

Sources13 archives

Databases and archives Filicium decipiens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility819 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS · NPASS16 compounds

Occurrence & distributionGBIF819 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Filicium decipiens, called the ferntree, fern tree or fern leaf tree, is a species of Filicium found in east Africa, Madagascar, India and Sri Lanka. It is planted as an ornamental tree in the Indian subcontinent, Indonesia, Hawaii, and elsewhere. As a street tree in Maui

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology7

Plant height6.5 m

Seed mass449 mg

⚠ sources differ — TRY: 449 mg · GIFT: 492 mg

Seed mass max885 mg

Seed mass min99.9 mg

Seed volume560 mm³

Seed volume max560 mm³

Seed volume min560 mm³

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density960 mg/cm³

03Chemical composition16 compounds

Compounds documented for Filicium decipiens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Cinnamic acids and derivatives5

Flavonols5

Flavones2

Neohopane triterpenoids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
1-O-Sinapoyl-beta-D-glucose	present	NPASS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-5-hydroxy-7-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
3,5-dihydroxy-2-(4-hydroxyphenyl)-7-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid	present	NPASS
[(2S,3R,4S,5S,6R)-4,5-dihydroxy-2-[(E)-3-(4-hydroxy-3,5-dimethoxyphenyl)prop-2-enoyl]oxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-3-yl] (E)-3-(4-hydroxy-3,5-dimethoxyphenyl)prop-2-enoate	present	NPASS
[(3S,3aS,5aR,5bR,6R,7S,7aR,9S,11aR,11bR,13aR,13bS)-7,9-dihydroxy-3a,5a,5b,11a-tetramethyl-8-methylidene-3-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-6-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
Astragalin	present	LOTUS
BMISSKQRNBABCG-SGEHCJBVSA-N	present	NPASS
I(2)-D-Glucopyranose, 6-O-[2-O-[(2E)-3-(4-hydroxy-3,5-dimethoxyphenyl)-1-oxo-2-propen-1-yl]-I(2)-D-glucopyranosyl]-, 1,2-bis[(2E)-3-(4-hydroxy-3,5-dimethoxyphenyl)-2-propenoate]	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Filicium decipiens has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences6

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX855138.1 ↗402 bpIndia · 2025

ACGT

GGACATTTGTCCGAAACCTGCAAAGCAGAACGACCCGCGAACGAGTTTCATTCGCTGGGGGAAGCCACGGGTGCGAGAGCCCCCGTGGTC …

Filicium decipiens voucher SCRIPCOG90FD internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Filicium decipiens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–322n range31median30mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, U. Chatterjee & D. Hazra. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 576–579.

2n 321×CCDB · book-fedorov

CCDB · book-fedorov — Guervin 1961b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.980 ↗

08Occurrence & distribution

Record type819 records

Wild obs. + sensor631

Museum / vouchered188

Range

Area of Occupancy AOO1 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 341≤1 km 48≤10 km 29>10 km 11

429 georeferenced · 202 without coordinates

Open the mapobservation + sensor631

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3>10 km 1

7 georeferenced · 181 without coordinates

Open the institutions mapphysical evidence188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	25
Kew, GB	11
Honolulu, US	10
UFRRJlocation not on record	9
BISHlocation not on record	8
Pondicherry, IN	8
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	7
Plocation not on record	7
Moscow State Universitylocation not on record	6
Seropédica, BR	5
University of Stellenboschlocation not on record	5
San Jose State University, Museum of Birds and Mammalslocation not on record	4
MeiseBGlocation not on record	4
Ivano-Frankivsk, UA	4
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	4
Bronx, US	4
Auckland, NZ	3
Arusha, TZ	3
Salvador, BR	3
Glocation not on record	3
Sri Ramaswamy Memorial Universitylocation not on record	3
JBRJlocation not on record	3
UFBAlocation not on record	3
EAlocation not on record	2
Universidade Federal do Rio Grande do Nortelocation not on record	2
WAGlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Gump Stationlocation not on record	1
Paris, FR	1
UFMGlocation not on record	1
ASUlocation not on record	1
Instituto de Investigação Científica Tropicallocation not on record	1
MAlocation not on record	1
St. Augustine, TT	1
PHlocation not on record	1
Laboratorio de Ictiologialocation not on record	1
Philadelphia, US	1
Instituto do Meio Ambientelocation not on record	1
TAFORI-LSRClocation not on record	1
DSMlocation not on record	1
École Nationale Supérieure Agronomiquelocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Université de la Réunionlocation not on record	1
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
UNESP-FCAlocation not on record	1
Chaguaramas, TT	1

49 institutions · 171 of 188 vouchered records shown · 17 without an institution code

09Environmental DNA8 detections

Where the DNA of Filicium decipiens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 23.7–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C 16.8–19.3

Precipitation109 mm/mo 33.3–109

Air humidity52.0 % 46.7–52.0

Moisture balance-17.8 mm/mo -91.6–-17.8

Vapour deficit1,616 Pa 1,579–1,616

Wind speed1.80 m/s 1.80–2.40

Cloud cover25.2 % 17.8–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)