Filago griffithii

(A.Gray) Andrés-Sánchez & Galbany · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Filago

At a glance

Occurrence records36

Data sources8

Biological traits19

DNA specimens3

eDNA detections8

Sources8 archives

Databases and archives Filago griffithii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF36 records

Environmental DNA2 datasets · 3 countries8 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT729 Mbp

01Narrative

Filago griffithii is a species of flowering plant in the family Asteraceae. It is found from the eastern Mediterranean to central Asia and Pakistan. This species is an annual herb coated with appressed gray hairs. The stem is very short and the branches extend outward, making the plant squat in stature, sometimes forming a patch on the ground. The alternately arranged leaves are linear. The disc-shaped flower heads are clustered in glomerules 1 or 2 centimeters wide. There are layers of tiny woolly phyllaries around the flower head. It contains usually 4 tubular florets each no more than 1.5 millimeters long.Cymbolaena griffithii. Flora of Pakistan. Cypselas from bisexual florets have deciduous white pappi, and those from female florets lack pappi.Abid, R. and M. Qaiser. (2008). (2)/PJB40(2)473.pdf Cypsela morphology of some genera in the tribe Gnaphalieae (Asteraceae) from Pakistan. Pak. J. Bot 40(2), 473-85.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.15 m

Plant height min0.01 m

Seed mass0.09 mg

Seed mass max0.09 mg

Seed mass min0.09 mg

Life cycle & reproduction5

Flowering endJul

Flowering startApr

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Elevation max2 000 m

Elevation min700 m

Growth formherb

Habitat GIFTdry rocky slopes in middle mountain and subalpine zones

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Filago griffithii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences1

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSFN645888.1 ↗640 bpArmenia

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACAACGGGCAATATAGGGATTGAGCTTTTGTTTGATCCTTAGTTGCCTTT …

Stylocline griffithii ITS1, 5.8S rRNA gene and ITS2, specimen voucher SALA 134833

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Filago griffithii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size728 658 900 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Filago griffithii0.73 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy2× diploid · measured

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

07Deep time~1.19 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.19 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type36 records

Wild obs. + sensor17

Museum / vouchered19

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 12≤1 km 1≤10 km 1

14 georeferenced · 3 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	12
Academy of Sciences of the Republic of Uzbekistanlocation not on record	3
Salamanca, ES	1
Wlocation not on record	1
Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record	1

5 institutions · 18 of 19 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Filago griffithii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 9.10–13.9

Seasonal swing summer↔winter29.7 °C

Max temp (day)17.2 °C 13.8–19.0

Min temp (night)4.90 °C 2.60–6.70

Precipitation67.7 mm/mo 56.2–71.0

Air humidity42.1 % 40.1–47.5

Moisture balance-94.8 mm/mo -116–-67.4

Vapour deficit819 Pa 676–983

Wind speed5.90 m/s 4.40–5.90

Cloud cover29.7 % 27.7–33.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)