Ficus watkinsiana

F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records1 245

Data sources12

Biological traits34

DNA specimens4

eDNA detections3

Sources12 archives

Databases and archives Ficus watkinsiana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 245 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF1 245 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Ficus watkinsiana, commonly known as strangler fig, Watkins' fig, nipple fig or the green-leaved Moreton Bay fig is a hemiepiphytic fig that is endemic to Australia. The species exists in three populations—one in northeast Queensland and the others in southeast Queensland and northeast New South Wales. It also has been introduced to Kauai island (Hawaiʻi). The pollinator of this species in Australia is Pleistodontes nigriventris (Girault).Jared Bernard et al.: New Species Assemblages Disrupt Obligatory Mutualisms Between Figs and Their Pollinators. In: Front. Ecol. Evol., 19 November 2020. doi:10.3389/fevo.2020.564653. See also: Jared Bernard: Figs show that nonnative species can invade ecosystems by forming unexpected partnerships. On: The Conversation. 19 January 2021. Also on Sciencealert On Kauai island, Port Jackson fig wasps (Pleistodontes imperialis) are able to do the job as substitute pollinators.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length32.5 mm

Fruit width30 mm

Leaf length150 mm

Leaf length max250 mm

Leaf length min100 mm

Leaf mass per area231 g/m2

Leaf size4 962 mm²

Leaf width70 mm

Leaf width max70 mm

Leaf width min30 mm

Petiole length5.5 cm

Plant height45 m

Seed length1 mm

Seed mass2.0 mg

⚠ sources differ — TRY: 2.0 mg · AusTraits: 1.15 mg

Seed width1 mm

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Fruit fleshinessfleshy

Fruit typesyconium

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: Hemi-epiphyte

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)4.32 mm²/mg

Wood density366 mg/cm³

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus watkinsiana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences3

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEF545669.1 ↗717 bp

ACGT

ACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAAGGACCGGCGAACACGTTATACAACACTCGAGGGGGGGCAAGGGGCGCGAAC …

Ficus watkinsiana isolate FWA-19 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ficus watkinsiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Australia

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~9.38 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin9.38 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 245 records

Wild obs. + sensor860

Museum / vouchered197

Cultivated / captive4

Other184

Origin

Native12

Introduced7

Range

Area of Occupancy AOO3 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 712≤1 km 69≤10 km 29>10 km 1

811 georeferenced · 49 without coordinates

Open the mapobservation + sensor860

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 20≤1 km 21≤10 km 79>10 km 21

141 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence197

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1>10 km 1

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	70
Brisbane, AU	39
Mount Annan, AU	19
Canberra, AU	16
Museo Entomologico de Leonlocation not on record	13
Palmerston, AU	7
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Riverside, US	3
James Cook Townsvillelocation not on record	3
Armidale, AU	3
Saint Louis, US	3
Kew, GB	2
Canadian Department of Agriculturelocation not on record	2
Auckland, NZ	2
Bronx, US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Miami, US	1
BIO-UNIPIlocation not on record	1
Adelaide, AU	1
ASUlocation not on record	1
Cambridge University Herbariumlocation not on record	1

21 institutions · 192 of 197 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Ficus watkinsiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 20.7–20.7

Seasonal swing summer↔winter8.90 °C

Max temp (day)23.7 °C

Min temp (night)18.0 °C

Precipitation139 mm/mo

Air humidity58.8 %

Moisture balance16.6 mm/mo

Vapour deficit1,009 Pa

Wind speed2.50 m/s

Cloud cover25.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ficus watkinsiana

At a glance

Sources12 archives

Size & morphology15

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type1 245 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 245 records