Ficus virgata

Reinw. ex Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records3 220

Data sources9

Biological traits39

DNA specimens20

eDNA detections14

Sources9 archives

Databases and archives Ficus virgata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 220 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF3 220 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB2n = 26

01Narrative

ハマイヌビワは、クワ科イチジク属の樹木。葉の基部が左右非対称になっている。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology13

Fruit length13.5 mm

Fruit width4.4 mm

Leaf length140 mm

Leaf size19 800 mm²

Leaf width70 mm

Petiole length1.25 cm

Plant height20 m

⚠ sources differ — GIFT: 20 m · AusTraits: 30 m

Seed length1 mm

Seed mass1.48 mg

Seed volume0.34 mm³

Seed volume max0.37 mm³

Seed volume min0.31 mm³

Seed width1 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typeanimal

Flowering endAug

Flowering startJul

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromebee

⚠ sources differ — AusTraits: bee · GIFT: insect

Resprouting capacityresprouts

Self fertilizationabsent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typesyconium

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: Hemi-epiphyte

Habitat GIFTrain forest, dry forest

Leaf compoundnesssimple

Leaf shapeelliptical oblong

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density538 mg/cm³

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus virgata has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes5

GenBank sequences10

eDNA detections14

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPQ110773.1 ↗596 bp

ACGT

TCCCCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAATATGAAGTC …

Ficus virgata voucher GX042 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL8★ITS★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Ficus virgata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · book-ipcn66

CCDB · book-ipcn66 — Pancho 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 220 records

Wild obs. + sensor2 031

Museum / vouchered922

Cultivated / captive3

Other264

Origin

Native30

Range

Area of Occupancy AOO5 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 019≤1 km 182≤10 km 40>10 km 56

1 297 georeferenced · 734 without coordinates

Open the mapobservation + sensor2 031

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 39≤1 km 26≤10 km 141>10 km 31

237 georeferenced · 685 without coordinates

Open the institutions mapphysical evidence922

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nishihara, JP	238
Brisbane, AU	83
Smithfield, AU	81
Paris, FR	56
Taipei, TW	49
Tsukuba, JP	45
Taipei, TW	43
National Museum of Natural Sciencelocation not on record	38
Taipei, TW	23
Museo Entomologico de Leonlocation not on record	22
TAIElocation not on record	20
Canberra, AU	17
Beijing, CN	16
Nishihara, JP	15
Honolulu, US	14
St. Paul, US	11
Palmerston, AU	10
Mount Annan, AU	7
BISHlocation not on record	7
Kagoshima, JP	5
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	4
Forestry and Forest Products Research Institutelocation not on record	4
Nagano City, JP	3
Bronx, US	3
Zürich, CH	2
James Cook Townsvillelocation not on record	2
Saint Louis, US	2
Sanda, JP	2
Cambridge University Herbariumlocation not on record	2
HAWlocation not on record	1
Rotorua, NZ	1
Bloomington, US	1
University of the Sunshine Coastlocation not on record	1
Davis, US	1
Qarshi Botanical Gardenlocation not on record	1
ASUlocation not on record	1
IPA/SPlocation not on record	1
TNMlocation not on record	1
Kew, GB	1
FFPRIlocation not on record	1
Kunming, CN	1

41 institutions · 836 of 922 vouchered records shown · 78 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Ficus virgata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–24.4

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C 9.60–25.1

Min temp (night)3.00 °C 3.00–23.6

Precipitation344 mm/mo 176–344

Air humidity64.9 % 60.2–64.9

Moisture balance263 mm/mo 4.80–263

Vapour deficit428 Pa 428–1,181

Wind speed2.90 m/s 2.90–4.90

Cloud cover44.6 % 32.4–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ficus virgata

At a glance

Sources9 archives

Size & morphology13

Life cycle & reproduction11

Diet & foraging1

Habitat & environment11

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 220 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 41 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 220 records