Ficus trichopoda

Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records785

Data sources8

Biological traits28

DNA specimens9

eDNA detections7

Sources8 archives

Databases and archives Ficus trichopoda's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility785 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF785 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Ficus trichopoda est une espèce de plantes à fleurs de la famille des Moraceae et du genre Ficus, présente en Afrique tropicale.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Plant height10 m

⚠ sources differ — GIFT: 10 m · TRY: 15 m

Plant height max24.38 m

Plant height min1.5 m

Seed mass0.14 mg

Seed mass max0.14 mg

Seed mass min0.14 mg

Seed volume0.12 mm³

Seed volume max0.12 mm³

Seed volume min0.12 mm³

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max300 m

Elevation min30 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus trichopoda has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences4

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSGQ504304.1 ↗667 bpSouth Africa · 2007

ACGT

ACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAAGGACCGGCGAAACACGTTACAACACTCGAGGGGGGGCAAGGGGCGCGAACA …

Ficus trichopoda isolate Fsp123 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type785 records

Wild obs. + sensor430

Museum / vouchered291

Other64

Origin

Native9

Range

Area of Occupancy AOO1 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 141≤1 km 22≤10 km 8>10 km 2

173 georeferenced · 257 without coordinates

Open the mapobservation + sensor430

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 287 without coordinates

Open the institutions mapphysical evidence291

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	38
HNBlocation not on record	30
Durban, ZA	26
MeiseBGlocation not on record	23
Saint Louis, US	22
Yaoundé, CM	16
Plocation not on record	12
Kew, GB	5
Herbier National du Gabonlocation not on record	5
LBVlocation not on record	4
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	3
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	3
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
BRLUlocation not on record	2
Instituto de Investigação Científica Tropicallocation not on record	2
University of Johannesburglocation not on record	2
Cape Town, ZA	2
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	2
Brussels, BE	2
Stockholm, SE	1
LSFlocation not on record	1
MSB-3054location not on record	1
South African National Biodiversity Institutelocation not on record	1
Université Nangui Abrogoualocation not on record	1
Centre D'Etude sur les Ressources Végétaleslocation not on record	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
IPHAMETRAlocation not on record	1
Xiamen, CN	1
Unknownlocation not on record	1
EFGlocation not on record	1
National Institute of Hygienic Scienceslocation not on record	1
WAGlocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
Daubeny Herbarium, Oxfordlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
South Kensington, GB	1
Université du Lomélocation not on record	1

37 institutions · 219 of 291 vouchered records shown · 72 without an institution code

09Environmental DNA7 detections

Where the DNA of Ficus trichopoda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 18.7–24.3

Seasonal swing summer↔winter5.80 °C

Max temp (day)24.2 °C 23.8–27.6

Min temp (night)21.0 °C 13.4–21.6

Precipitation89.4 mm/mo 44.7–182

Air humidity61.9 % 58.2–67.2

Moisture balance4.00 mm/mo

Vapour deficit995 Pa 885–1,046

Wind speed4.30 m/s

Cloud cover29.6 % 18.5–34.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)