Ficus semicordata

Buch.-Ham. ex Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records435

Data sources6

Biological traits44

DNA specimens10

eDNA detections9

Sources6 archives

Databases and archives Ficus semicordata's data was compiled from.

GBIFGlobal Biodiversity Information Facility435 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources44 traits

Occurrence & distributionGBIF435 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI10 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Leaf length230 mm

Leaf length max280 mm

Leaf length min180 mm

Leaf size85 000 mm²

Leaf width100 mm

Leaf width max110 mm

Leaf width min90 mm

Plant height8.25 m

⚠ sources differ — GIFT: 8.25 m · TRY: 10 m

Plant height max10 m

Plant height min3 m

Seed mass0.951 mg

Seed mass max1 mg

Seed mass min1 mg

Seed volume0.9 mm³

Seed volume max0.9 mm³

Seed volume min0.9 mm³

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 100 m

Elevation min600 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Leaf formelliptic

Woodinesswoody

Physiology & chemistry6

Leaf c386 mg/g

Leaf dry-matter content (LDMC)335 mg/g

Leaf n20.02 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)11.5 mm²/mg

⚠ sources differ — TRY: 11.5 mm²/mg · GIFT: 13.22 mm²/mg

Other traits6

Leaf marginentire

Leaf spinesno

Leaf thornsno

Plant support typefree-standing

Sla max13.22 mm²/mg

Sla min13.22 mm²/mg

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus semicordata has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKR532137.1 ↗415 bp

ACGT

GAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTG …

Ficus semicordata isolate BB0284 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type435 records

Wild obs. + sensor70

Museum / vouchered325

Other40

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 21≤1 km 13≤10 km 3>10 km 1

38 georeferenced · 32 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 2≤10 km 3>10 km 41

46 georeferenced · 279 without coordinates

Open the institutions mapphysical evidence325

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	57
Kunming, CN	54
Natural History Museum, Tribhuvan Universitylocation not on record	45
Edinburgh, GB	20
CASlocation not on record	18
Guilin, CN	15
Yangling, CN	12
Guangzhou, CN	11
Taipei, TW	9
Saint Louis, US	8
Cambridge, US	5
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	5
University of Stellenboschlocation not on record	5
Paris, FR	4
Central China Normal Universitylocation not on record	3
Bronx, US	2
Guiyang, CN	2
Xining, CN	2
Nanjing, CN	2
Yunnan Universitylocation not on record	2
Southwest Forestry Collegelocation not on record	2
Chengdu, CN	1
Xiamen, CN	1
Taipei, TW	1
LDlocation not on record	1
Siouxland Heritage Museumlocation not on record	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1

28 institutions · 290 of 325 vouchered records shown · 31 without an institution code

09Environmental DNA9 detections

Where the DNA of Ficus semicordata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.1 °C 10.0–24.7

Seasonal swing summer↔winter31.5 °C

Max temp (day)26.1 °C 15.7–30.2

Min temp (night)16.8 °C 3.10–17.8

Precipitation32.7 mm/mo 13.8–140

Air humidity47.2 % 45.7–62.9

Moisture balance-95.2 mm/mo -164–20.5

Vapour deficit1,042 Pa 767–1,642

Wind speed4.50 m/s 1.90–4.80

Cloud cover29.9 % 24.1–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)