Ficus sagittata

J.Koenig ex Vahl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records352

Data sources13

Biological traits28

DNA specimens22

eDNA detections18

Sources13 archives

Databases and archives Ficus sagittata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility352 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF352 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD · NCBI22 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Ficus sagittataKönig J, ex Vahl M (1805) In: Symb. Bot. 1: 83. is a trailing fig species, in the family Moraceae, which can be found in southern China, Indo-China and Malesia. In Vietnam it may be called sung dầu tên or sung bò. No subspecies are listed in the Catalogue of Life.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length12 mm

Fruit width12 mm

Leaf length100 mm

Leaf length max130 mm

Leaf length min70 mm

Leaf size4 266 mm²

Leaf width75 mm

Leaf width max100 mm

Leaf width min50 mm

Seed volume0.47 mm³

Seed volume max0.47 mm³

Seed volume min0.47 mm³

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal typeanimal

Life formliana

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Habitat & environment7

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeother

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)13.29 mm²/mg

03Chemical composition7 compounds

Compounds documented for Ficus sagittata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Simple coumarins2

Stigmastane steroids2

Cinnamic acids and derivatives1

Flavonols1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
2-O-Glucosyloxy-4-methoxycinnamic acid	present	LOTUS
7-Methoxychroman-2-one	present	LOTUS
beta-Sitosterol	present	LOTUS
Herniarin	present	LOTUS
quercetin-3-O-xyloso-rhamnoside	present	LOTUS
Scopoletin	present	LOTUS
Sitogluside	present	LOTUS

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus sagittata has left across the world's sequence archives.

At a glance

DNA specimens22

Marker genes4

GenBank sequences10

eDNA detections18

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKR532136.1 ↗312 bp

ACGT

AGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTCGAGGGCACGTCTGCCTGGGCGTCACACGCCGTTGCTCCCCCCCGAAGCCCCT …

Ficus sagittata isolate BB0305 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ficus sagittata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×CCDB · book-ipcn66

CCDB · book-ipcn66 — Pancho 1966

CCDB · book-ipcn66 — Pancho1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type352 records

Wild obs. + sensor27

Museum / vouchered302

Cultivated / captive2

Other21

Range

Area of Occupancy AOO732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 13≤1 km 4≤10 km 2>10 km 3

22 georeferenced · 5 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 2>10 km 3

6 georeferenced · 296 without coordinates

Open the institutions mapphysical evidence302

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	32
Beijing, CN	23
Guilin, CN	15
Bronx, US	13
Nanjing, CN	10
Kew, GB	9
Cibinong Science Center, Herbarium Bogorienselocation not on record	6
Guangzhou, CN	5
Saint Louis, US	5
Paris, FR	4
Honolulu, US	3
SCAUlocation not on record	3
Siouxland Heritage Museumlocation not on record	3
Cincinnati, US	3
St. Paul, US	2
Llocation not on record	2
University of Stellenboschlocation not on record	2
Chengdu, CN	2
Xiamen, CN	2
Anhui Normal Universitylocation not on record	2
DOI/NPS, Colonial National Historical Parklocation not on record	1
Kagoshima, JP	1
Cibinong, ID	1
Changsha, CN	1
Hangzhou, CN	1
Columbia, US	1

26 institutions · 152 of 302 vouchered records shown · 138 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA18 detections

Where the DNA of Ficus sagittata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C -5.20–26.1

Seasonal swing summer↔winter31.5 °C

Max temp (day)29.5 °C 0.6–30.2

Min temp (night)17.8 °C -10.9–22.6

Precipitation32.7 mm/mo 0.9–269

Air humidity47.2 % 45.7–68.1

Moisture balance-95.2 mm/mo -164–133

Vapour deficit1,080 Pa 215–1,642

Wind speed4.50 m/s 1.20–4.80

Cloud cover29.9 % 16.4–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)