Ficus reflexa

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records1 336

Data sources5

Biological traits17

DNA specimens0

eDNA detections1

Sources5 archives

Databases and archives Ficus reflexa's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF1 336 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology6

Seed mass0.279 mg

⚠ sources differ — TRY: 0.279 mg · GIFT: 0.26 mg

Seed mass max0.33 mg

Seed mass min0.19 mg

Seed volume0.22 mm³

Seed volume max0.22 mm³

Seed volume min0.22 mm³

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus reflexa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY700354.1 ↗422 bp

ACGT

TTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTCGAGGGCACGTCTGCCTGGGCGTCACACGCCGTTGCCCCCCCAACCCCCGAAACCCG …

Ficus reflexa isolate FIRE_P.C_1of3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type1 336 records

Wild obs. + sensor658

Museum / vouchered663

Other15

Origin

Native1

Range

Area of Occupancy AOO1 340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 67≤1 km 1≤10 km 249>10 km 337

654 georeferenced · 4 without coordinates

Open the mapobservation + sensor658

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 13≤1 km 5≤10 km 7>10 km 1

26 georeferenced · 637 without coordinates

Open the institutions mapphysical evidence663

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	134
Plocation not on record	100
Kew, GB	95
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	88
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	40
Glocation not on record	23
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	21
CJBGlocation not on record	19
MeiseBGlocation not on record	14
WAGlocation not on record	11
Stockholm, SE	9
Bronx, US	7
Paris, FR	7
CASlocation not on record	7
University of Stellenboschlocation not on record	6
Pretoria, ZA	4
ASUlocation not on record	3
Universidad de Caldas (UCaldas)location not on record	3
Llocation not on record	2
Ulocation not on record	2
Museo Entomologico de Leonlocation not on record	1
MAlocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Zlocation not on record	1
Cambridge, US	1
Ann Arbor, US	1

26 institutions · 601 of 663 vouchered records shown · 62 without an institution code

09Environmental DNA1 detections

Where the DNA of Ficus reflexa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ficus reflexa

At a glance

Sources5 archives

Size & morphology6

Life cycle & reproduction2

Habitat & environment7

Physiology & chemistry1

Other traits1

At a glance

Record type1 336 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 336 records