Ficus pertusa
L.fil. · speciesAt a glance
Occurrence records4 934
Data sources8
Biological traits36
DNA specimens38
eDNA detections20
Sources8 archives
Databases and archives Ficus pertusa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 934 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources36 traits
Occurrence & distributionGBIF4 934 records
Environmental DNA1 datasets · 6 countries20 detections
DNA & barcodingBOLD · NCBI38 specimens
01Narrative
Ficus radicans é uma espécie de planta com flor pertencente à família Moraceae. A autoridade científica da espécie é Desf., tendo sido publicada em Tableau de l'École de Botanique ed. 3: 413. 1829.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology8
Leaf size3 000 mm²
Plant height5 m
⚠ sources differ — GIFT: 5 m · TRY: 15.5 m
Plant height max20 m
Seed length max6 mm
Seed length min1 mm
Seed volume0.001 mm³
Seed volume max0.001 mm³
Seed volume min0.001 mm³
Life cycle & reproduction7
Deciduousnessevergreen
Dispersal typeanimal
Life formtree
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max2 000 m
Elevation mean348 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Growth formtree
Habitat GIFTCaatinga (stricto sensu), Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Estacional Decidual, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga
Woodinesswoody
Physiology & chemistry9
Leaf C:N ratio18.84 g/g
Leaf c424 mg/g
Leaf dry-matter content (LDMC)262 mg/g
Leaf n20.69 mg/g
Leaf p1.1 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)11.9 mm²/mg
Wood density413 mg/cm³
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus pertusa has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes5
GenBank sequences10
eDNA detections20
Countries6
The DNA barcodea real sequence read deposited for this species
ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGNAGGACCGGCGAACACGTTACAACACTCGAGGGG …
Ficus pertusa voucher P. Costa AM 60 (SPFR) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL8★rbcLa★ITS1★ITS2
plant barcodefungal barcode
08Occurrence & distribution
Record type4 934 records
Wild obs. + sensor716
Museum / vouchered3 975
Cultivated / captive1
Other242
Origin
Native228
Range
Area of Occupancy AOO8 464 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 152≤1 km 40≤10 km 11>10 km 7
210 georeferenced · 506 without coordinates
Open the mapobservation + sensor716
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy88% within 1 km
≤100 m 821≤1 km 66≤10 km 70>10 km 56
1 013 georeferenced · 2 962 without coordinates
Open the institutions mapphysical evidence3 975
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions77 of 185 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 642 |
| Durango, MX | 548 |
| Mexico City, MX | 353 |
| National Biodiversity Institute, Costa Ricalocation not on record | 210 |
| Bronx, US | 176 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 137 |
| University of Stellenboschlocation not on record | 101 |
| Chicago, US | 78 |
| Kew, GB | 78 |
| Austin, US | 74 |
| Antiguo Cuscatlán, SV | 68 |
| JBRJlocation not on record | 51 |
| Berlin, DE | 51 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 46 |
| UFMSlocation not on record | 41 |
| Mérida, MX | 40 |
| Riverside, US | 35 |
| Universiti Sains Malaysialocation not on record | 33 |
| Tapachula, MX | 33 |
| MEXUlocation not on record | 32 |
| San Francisco, US | 32 |
| QCNElocation not on record | 31 |
| ASUlocation not on record | 31 |
| Universidad Nacional de Colombia (UNAL)location not on record | 29 |
| Brasília, BR | 27 |
| Loja, EC | 27 |
| León, NI | 26 |
| Cenargenlocation not on record | 25 |
| Laboratorio de Ictiologialocation not on record | 25 |
| HUT Culture Collectionlocation not on record | 24 |
| Brasília, BR | 23 |
| San José, CR | 23 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 22 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 21 |
| Universidad de Antioquia (UdeA)location not on record | 21 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 20 |
| Mexico City, MX | 20 |
| arosemena tola, EC | 18 |
| UnBlocation not on record | 18 |
| Chongqing Museumlocation not on record | 17 |
| Museu Paraense Emílio Goeldilocation not on record | 16 |
| Austin, US | 16 |
| Bergen, NO | 15 |
| Tuxtla Gutiérrez, MX | 14 |
| South Kensington, GB | 14 |
| Aarhus, DK | 14 |
| Paris, FR | 14 |
| Santa Cruz de la Sierra, BO | 13 |
| Chapingo, MX | 13 |
| Durham, US | 12 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 12 |
| Lima, PE | 12 |
| Guatemala City, GT | 12 |
| MAlocation not on record | 12 |
| IPA/SPlocation not on record | 11 |
| San Francisco de Campeche, MX | 11 |
| Juriquilla, MX | 11 |
| USP-IBlocation not on record | 11 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 10 |
| Provincia di Livornolocation not on record | 10 |
| Istituto Agrario Castelnuovolocation not on record | 10 |
| San Diego, US | 9 |
| Xiamen, CN | 9 |
| UTPLlocation not on record | 9 |
| Fort Worth, US | 9 |
| Chaguaramas, TT | 8 |
| CASlocation not on record | 8 |
| UNESP-FCAlocation not on record | 8 |
| Area de Conservacion Guanacastelocation not on record | 8 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 7 |
| La Paz, BO | 7 |
| Tampa, US | 7 |
| Autlán de Navarro, MX | 7 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 7 |
| Cambridge, US | 6 |
| The University of Arizonalocation not on record | 6 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 6 |
| Wlocation not on record | 6 |
| Hermosillo, MX | 6 |
| Fredericksburg, US | 6 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 5 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 5 |
| Universidade do Estado de Mato Grossolocation not on record | 5 |
| Moscow State Universitylocation not on record | 4 |
| UFVJMlocation not on record | 4 |
| UNICAMPlocation not on record | 4 |
| Universidade Federal de Goiáslocation not on record | 4 |
| Iquitos, PE | 4 |
| HEMlocation not on record | 4 |
| Stockholm, SE | 3 |
| NO DISPONIBLElocation not on record | 3 |
| HUAlocation not on record | 3 |
| Quito, EC | 3 |
| Universidad Nacional Agraria La Molina, Herbariolocation not on record | 3 |
| UNEMATlocation not on record | 3 |
| Boise, US | 3 |
| Uberlândia, BR | 3 |
| OTSlocation not on record | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| Ural Federal University "B. N. Yeltsin"location not on record | 3 |
| Bogotá, D.C., CO | 3 |
| Porto Alegre, BR | 3 |
| LDlocation not on record | 3 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 3 |
| Bloomington, US | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| GeoPark Colombia S.A.S (GeoPark)location not on record | 2 |
| La Paz, MX | 2 |
| UFMGlocation not on record | 2 |
| St. Paul, US | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| INMAlocation not on record | 2 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 2 |
| Escuela Agrícola Panamericanalocation not on record | 2 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 2 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 2 |
| BAYLUlocation not on record | 2 |
| University of Johannesburglocation not on record | 2 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 2 |
| Cusco, PE | 2 |
| Guasave, MX | 2 |
| EL PASO, US | 2 |
| Ciudad de México, MX | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| Puebla, MX | 2 |
| Ann Arbor, US | 2 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 2 |
| Herbario UTCEClocation not on record | 2 |
| Ivano-Frankivsk, UA | 2 |
| BMlocation not on record | 2 |
| Universität Göttingenlocation not on record | 2 |
| UEPAlocation not on record | 2 |
| Tlalnepantla, MX | 2 |
| Paleontological Collectionlocation not on record | 2 |
| Claremont, US | 2 |
| CEPLAClocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| DOI/NPS, Chamizal National Memoriallocation not on record | 1 |
| San Isidro, AR | 1 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 1 |
| UEMlocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Corrientes, AR | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Edinburgh, GB | 1 |
| UFPRlocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Miami, US | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Criciúma, BR | 1 |
| MeiseBGlocation not on record | 1 |
| Londrina, BR | 1 |
| UFBAlocation not on record | 1 |
| UFAClocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| CHAPAlocation not on record | 1 |
| UNESClocation not on record | 1 |
| BGBMlocation not on record | 1 |
| IAvHlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Fortaleza, BR | 1 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 1 |
| Maringá, BR | 1 |
| Université de Bordeauxlocation not on record | 1 |
| COLlocation not on record | 1 |
| Llocation not on record | 1 |
| QAPlocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Mlocation not on record | 1 |
| Toluca, MX | 1 |
| Barcelona, ES | 1 |
| Cuiabá, BR | 1 |
| Porto Velho, BR | 1 |
| Universidade Paulistalocation not on record | 1 |
| HACAMlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas SINCHIlocation not on record | 1 |
185 institutions · 3 909 of 3 975 vouchered records shown · 66 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Ficus pertusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.2 °C 21.1–26.6
Seasonal swing summer↔winter2.60 °C
Max temp (day)27.7 °C 25.5–31.2
Min temp (night)21.4 °C 14.8–22.8
Precipitation56.7 mm/mo 13.3–313
Air humidity63.5 % 53.9–69.3
Moisture balance-56.7 mm/mo -142–166
Vapour deficit1,006 Pa 938–1,410
Wind speed2.90 m/s 1.00–4.60
Cloud cover31.5 % 14.6–46.0
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.