Ficus obliqua

G.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records2 188

Data sources11

Biological traits49

DNA specimens4

eDNA detections3

Sources11 archives

Databases and archives Ficus obliqua's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 188 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources49 traits

Occurrence & distributionGBIF2 188 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Ficus obliqua est une espèce d'arbre de la famille des Moraceae répandu à travers une grande partie de l'Asie du Sud-Est (Indonésie) et l'Océanie. L'arbre est aussi appelé banian blanc en Nouvelle-Calédonie. Il peut ne pas posséder des racines aériennes. Ses feuilles sont vertes et petites. Ses fruits sont ronds, lisses, jaunes à orange.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology21

Fruit length8 mm

⚠ sources differ — AusTraits: 8 mm · GIFT: 6 mm

Fruit width8 mm

⚠ sources differ — AusTraits: 8 mm · GIFT: 6 mm

Leaf length80 mm

Leaf length max130 mm

Leaf length min30 mm

Leaf mass137 mg

Leaf mass per area125 g/m2

Leaf size2 959 mm²

⚠ sources differ — TRY: 2 959 mm² · AusTraits: 1 691 mm²

Leaf width25 mm

Leaf width max60 mm

Leaf width min15 mm

Petiole length1.25 cm

Plant height40 m

⚠ sources differ — GIFT: 40 m · AusTraits: 45 m · TRY: 40 m

Seed length1 mm

Seed mass0.44 mg

Seed mass max0.44 mg

Seed mass min0.44 mg

Seed volume0.38 mm³

Seed volume max0.38 mm³

Seed volume min0.38 mm³

Seed width1 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typeanimal

Flowering endJun

Flowering startApr

Life formtree

Life spanperennial

Lifespan years1 000 years

Pollination modebiotic

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typesyconium

⚠ sources differ — AusTraits: syconium · GIFT: other

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: Hemi-epiphyte

Habitat GIFTrain forest, dry forest

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate oblong

Succulenceno

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.63 mm²/mg

Wood density506 mg/cm³

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus obliqua has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF545659.1 ↗745 bp

ACGT

AAGTGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCTGCCCAGCAGAAGGACCGGCGAACACGTTATACAACA …

Ficus obliqua isolate FOB-9 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Ficus obliqua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — 1933

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 188 records

Wild obs. + sensor898

Museum / vouchered732

Cultivated / captive5

Other553

Origin

Native71

Introduced1

Range

Area of Occupancy AOO5 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 636≤1 km 86≤10 km 34>10 km 8

764 georeferenced · 134 without coordinates

Open the mapobservation + sensor898

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 113≤1 km 86≤10 km 225>10 km 63

487 georeferenced · 245 without coordinates

Open the institutions mapphysical evidence732

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 2 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	189
Smithfield, AU	121
Mount Annan, AU	68
Canberra, AU	58
Museo Entomologico de Leonlocation not on record	51
Paris, FR	35
Palmerston, AU	33
Armidale, AU	17
Auckland, NZ	16
Bronx, US	15
James Cook Townsvillelocation not on record	9
Adelaide, AU	8
Honolulu, US	8
Wollongong, AU	7
Batemans Bay, AU	5
BISHlocation not on record	5
University of Stellenboschlocation not on record	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Saint Louis, US	3
Wellington, NZ	3
St. Paul, US	3
Zürich, CH	3
Hobart, AU	2
Université de Strasbourglocation not on record	2
Severin-McDaniel Insect Collectionlocation not on record	2
Christchurch, NZ	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Wlocation not on record	1
Rotorua, NZ	1
Miami, US	1
Chongqing Museumlocation not on record	1
Cincinnati, US	1
Riverside, US	1
Taipei, TW	1
Cambridge University Herbariumlocation not on record	1

35 institutions · 681 of 732 vouchered records shown · 51 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Ficus obliqua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 21.7–21.7

Seasonal swing summer↔winter8.50 °C

Max temp (day)24.5 °C

Min temp (night)19.1 °C

Precipitation92.6 mm/mo

Air humidity59.4 %

Moisture balance-36.2 mm/mo

Vapour deficit1,060 Pa

Wind speed2.60 m/s

Cloud cover28.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ficus obliqua

At a glance

Sources11 archives

Size & morphology21

Life cycle & reproduction11

Diet & foraging1

Habitat & environment12

Physiology & chemistry4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 188 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 188 records