Ficus neriifolia

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records341

Data sources6

Biological traits29

DNA specimens2

eDNA detections8

Sources6 archives

Databases and archives Ficus neriifolia's data was compiled from.

GBIFGlobal Biodiversity Information Facility341 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF341 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length12 mm

Fruit length max14 mm

Fruit length min10 mm

Leaf length105 mm

Leaf length max180 mm

Leaf length min60 mm

Leaf width36.25 mm

Leaf width max65 mm

Leaf width min20 mm

Plant height13.5 m

⚠ sources differ — GIFT: 13.5 m · TRY: 15 m

Life cycle & reproduction7

Deciduousnessdeciduous

Flowering endOct

Flowering startMay

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Elevation max3 200 m

Elevation mean1 133 m

Elevation min219 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus neriifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY388572.1 ↗608 bp

ACGT

TTACAACACCCGAGGGGGGCGGGGGGGCGAACGCGCCCCCGACCCTCCTCGCCGGGTGCGTGTGGCCCCGCCCCTCGCCCCCGGCACCAA …

Ficus neriifolia voucher 2013011 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS2

fungal barcode

08Occurrence & distribution

Record type341 records

Wild obs. + sensor8

Museum / vouchered245

Other88

Origin

Native77

Range

Area of Occupancy AOO408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 6 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 244 without coordinates

Open the institutions mapphysical evidence245

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	80
Beijing, CN	53
Taipei, TW	43
Edinburgh, GB	17
Cambridge, US	9
Chengdu, CN	6
Bronx, US	5
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	4
Cambridge, US	3
Kew, GB	3
Paris, FR	2
University of Stellenboschlocation not on record	2
Shanxi Universitylocation not on record	1
Taipei, TW	1
Riverside, US	1
Chengdu, CN	1
Guangzhou, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1
MeiseBGlocation not on record	1

19 institutions · 234 of 245 vouchered records shown · 10 without an institution code

09Environmental DNA8 detections

Where the DNA of Ficus neriifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 10.0–20.8

Seasonal swing summer↔winter21.2 °C

Max temp (day)25.6 °C 15.7–27.4

Min temp (night)12.2 °C 3.10–14.4

Precipitation9.00 mm/mo 9.00–21.3

Air humidity51.6 % 45.7–51.6

Moisture balance-66.4 mm/mo -123–-66.4

Vapour deficit1,007 Pa 827–1,261

Wind speed2.00 m/s 2.00–4.60

Cloud cover26.4 % 24.1–27.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)