Ficus ilicina

(Sond.) Miq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records220

Data sources6

Biological traits19

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Ficus ilicina's data was compiled from.

GBIFGlobal Biodiversity Information Facility220 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF220 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height5 m

Plant height max5 m

Plant height min1 m

Seed mass0.509 mg

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 450 m

Elevation min133 m

Epiphyteterrestrial

Growth formtree

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus ilicina has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHM746960.1 ↗492 bp

ACGT

GTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA …

Ficus ilicina isolate Sw01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type220 records

Wild obs. + sensor164

Museum / vouchered56

Origin

Native1

Range

Area of Occupancy AOO648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 96≤1 km 18≤10 km 6>10 km 19

139 georeferenced · 25 without coordinates

Open the mapobservation + sensor164

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 56 records without

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	49
University of Stellenboschlocation not on record	2
Cape Town, ZA	1
South African National Biodiversity Institutelocation not on record	1

4 institutions · 53 of 56 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Ficus ilicina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter15.9 °C

Max temp (day)26.4 °C

Min temp (night)11.0 °C

Precipitation35.2 mm/mo

Air humidity47.4 %

Moisture balance-102 mm/mo

Vapour deficit1,175 Pa

Wind speed3.40 m/s

Cloud cover16.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)