Ficus heterophylla

L.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records140

Data sources7

Biological traits23

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Ficus heterophylla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF140 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Ficus repens là một loài thực vật có hoa trong họ Moraceae. Loài này được Roxb. ex Sm. mô tả khoa học đầu tiên năm 1810.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf length85 mm

Leaf length max100 mm

Leaf length min70 mm

Leaf width32.5 mm

Leaf width max40 mm

Leaf width min25 mm

Plant height max6 m

Life cycle & reproduction5

Life formshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density460 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus heterophylla has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP093102.1 ↗522 bpChina

ACGT

CAAACGAACCCCGGCGCGGAATGCGTCAAGGAAAGACAACGAGACGATCCCCGCCGTCGAGGCCCCGGAAACGGTGACTCTGCCTCGGTG …

Ficus heterophylla isolate SCBGP262_1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type140 records

Wild obs. + sensor13

Museum / vouchered120

Other7

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 8≤1 km 3>10 km 1

12 georeferenced · 1 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 1>10 km 1

4 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	22
Beijing, CN	13
Paris, FR	6
Guilin, CN	5
Kew, GB	3
Bronx, US	2
Guangzhou, CN	2
Baroda, IN	2
Chengdu, CN	2
Universidad de Caldas (UCaldas)location not on record	1
Zhejiang Universitylocation not on record	1
Vietnam National Museum of Naturelocation not on record	1
Stockholm, SE	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
Nanjing, CN	1
Saint Louis, US	1
Central China Normal Universitylocation not on record	1
Universität Göttingenlocation not on record	1
Siouxland Heritage Museumlocation not on record	1
South China Normal Universitylocation not on record	1
Fort Worth, US	1
Edinburgh, GB	1

22 institutions · 70 of 120 vouchered records shown · 50 without an institution code

09Environmental DNA3 detections

Where the DNA of Ficus heterophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)