Ficus hederacea

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records203

Data sources9

Biological traits15

DNA specimens11

eDNA detections11

Sources9 archives

Databases and archives Ficus hederacea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF203 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Ficus hederaceaRoxburgh W (1832) In: Fl. Ind. ed. 1832, 3: 538. is a climbing fig species, in the family Moraceae, which can be found in the Himalayas, southern China and Indo-China. In Vietnam it may be called sung leo. No subspecies are listed in the Catalogue of Life.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length85 mm

Leaf length max110 mm

Leaf length min60 mm

Leaf width42.5 mm

Leaf width max50 mm

Leaf width min35 mm

Life cycle & reproduction2

Life formclimbing shrub

Life spanperennial

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min80 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Climber

Woodinesswoody

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus hederacea has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes4

GenBank sequences10

eDNA detections11

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG897230.1 ↗580 bpChina

ACGT

CACGTTAAAACACCCGAGGGGGGTGAGGGGCGAACACGCCCCGGACCCTCCTCGCCGGGTGCGTGTGGCCCCGGCCCTCGCCCCTGGCAC …

Ficus hederacea voucher 2011105 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ficus hederacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×CCDB · book-ipcn66 · CCDB · book-indian_vol1

CCDB · book-ipcn66 — Larsen 1966a

CCDB · book-indian_vol1 — Kundu, D. & Sharma. A. 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type203 records

Wild obs. + sensor18

Museum / vouchered181

Other4

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 2>10 km 1

4 georeferenced · 14 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 179 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	50
Guilin, CN	30
Guangzhou, CN	29
Bronx, US	8
Chengdu, CN	6
Nanjing, CN	3
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	3
Hangzhou, CN	3
Kew, GB	3
Siouxland Heritage Museumlocation not on record	2
Guangzhou, CN	2
Museo Entomologico de Leonlocation not on record	2
Saint Louis, US	1
Changsha, CN	1
Guiyang, CN	1
Wuhan, CN	1
Edinburgh, GB	1
Paris, FR	1
Yangling, CN	1
Riverside, US	1

20 institutions · 149 of 181 vouchered records shown · 20 without an institution code

09Environmental DNA11 detections

Where the DNA of Ficus hederacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 10.0–24.7

Seasonal swing summer↔winter31.5 °C

Max temp (day)30.2 °C 15.7–30.2

Min temp (night)17.8 °C 3.10–17.8

Precipitation32.7 mm/mo 13.8–32.7

Air humidity47.2 % 45.7–47.2

Moisture balance-164 mm/mo -164–-95.2

Vapour deficit1,642 Pa 827–1,642

Wind speed4.80 m/s 4.50–4.80

Cloud cover29.9 % 24.1–29.9

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)