Ficus glaberrima

Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records393

Data sources6

Biological traits27

DNA specimens14

eDNA detections9

Sources6 archives

Databases and archives Ficus glaberrima's data was compiled from.

GBIFGlobal Biodiversity Information Facility393 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF393 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI14 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf length150 mm

Leaf length max200 mm

Leaf length min100 mm

Leaf width50 mm

Leaf width max70 mm

Leaf width min30 mm

Plant height15 m

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 500 m

Elevation mean1 025 m

Elevation min550 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Hemi-epiphyte

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry3

Leaf n17.8 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus glaberrima has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes6

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR479803.1 ↗366 bpThailand · 2004

ACGT

GGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAAGCCATCAGGTCGAGGGCACGTCTGCCTGGGC …

Ficus glaberrima voucher BBH1929 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS5★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type393 records

Museum / vouchered328

Other65

Range

Area of Occupancy AOO628 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 326 without coordinates

Open the institutions mapphysical evidence328

10Collections & institutions

Holding institutions19 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	98
Guangzhou, CN	53
Guilin, CN	44
Nanjing, CN	12
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	11
Chengdu, CN	10
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	9
Central China Normal Universitylocation not on record	8
Bronx, US	7
Siouxland Heritage Museumlocation not on record	6
BISHlocation not on record	6
Honolulu, US	6
Paris, FR	5
Edinburgh, GB	3
Changsha, CN	3
South China Normal Universitylocation not on record	3
St. Paul, US	2
Saint Louis, US	2
University of Stellenboschlocation not on record	2
Kew, GB	2
South Kensington, GB	1
Xining, CN	1
SCAUlocation not on record	1
Guiyang, CN	1
CASlocation not on record	1
Guangzhou, CN	1
Kagoshima, JP	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
National Institute of Biological Resourceslocation not on record	1
Cibinong Science Center, Herbarium Bogorienselocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Stockholm, SE	1

32 institutions · 304 of 328 vouchered records shown · 22 without an institution code

09Environmental DNA9 detections

Where the DNA of Ficus glaberrima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 0.9–25.9

Seasonal swing summer↔winter31.5 °C

Max temp (day)21.6 °C 6.60–29.8

Min temp (night)12.2 °C -5.30–22.0

Precipitation32.7 mm/mo 6.00–161

Air humidity48.4 % 46.3–65.3

Moisture balance-28.6 mm/mo

Vapour deficit827 Pa 400–1,479

Wind speed4.50 m/s

Cloud cover29.9 % 19.5–48.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)