Ficus craterostoma

Warb. ex Mildbr. & Burret · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records389

Data sources9

Biological traits17

DNA specimens2

eDNA detections4

Sources9 archives

Databases and archives Ficus craterostoma's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF389 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Ficus craterostoma, a species of strangler fig, is a fig shrub or tree of the Afrotropics that may grow up to 20 m tall. It is found in lowland tropical and swamp forests in the west, or in afromontane forests, including rocky situations, along Africa's eastern escarpments. The western and eastern populations may constitute separate species, as they occur at different altitudes where their ranges meet in central Africa, while they seem to have exclusive pollinating wasp species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height5 m

⚠ sources differ — GIFT: 5 m · TRY: 10 m

Plant height max15 m

Plant height min1 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 135 m

Elevation min200 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus craterostoma has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences4

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSGQ504308.1 ↗594 bpCameroon · 2007

ACGT

ACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGTAGAAAGACCGGCGAACACGTTACAACACTCGAGGGGGGCCAAGGGGCGCGAAAAC …

Ficus craterostoma isolate Fsp172 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type389 records

Wild obs. + sensor91

Museum / vouchered267

Other31

Origin

Native7

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 46≤1 km 14≤10 km 4>10 km 1

65 georeferenced · 26 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced · 264 without coordinates

Open the institutions mapphysical evidence267

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	61
MeiseBGlocation not on record	24
Saint Louis, US	23
Durban, ZA	18
Kew, GB	15
Cape Town, ZA	13
WAGlocation not on record	8
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	5
Yaoundé, CM	4
Plocation not on record	4
San Jose State University, Museum of Birds and Mammalslocation not on record	3
University of Johannesburglocation not on record	2
LNBG$location not on record	2
LBVlocation not on record	2
Paris, FR	2
MAlocation not on record	2
EAlocation not on record	2
Herbier National du Gabonlocation not on record	2
Glocation not on record	2
Njala Universitylocation not on record	2
BRLUlocation not on record	1
CJBGlocation not on record	1
Botanic Gardenlocation not on record	1
University of Sierra Leone, Fourah Bay Collegelocation not on record	1
Berlin, DE	1
DSMlocation not on record	1
LGlocation not on record	1
Instituto de Investigação Científica Tropicallocation not on record	1
BRVUlocation not on record	1
Arusha, TZ	1
LISClocation not on record	1
Elocation not on record	1
University of Oxfordlocation not on record	1
Edinburgh, GB	1
South Kensington, GB	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1

36 institutions · 212 of 267 vouchered records shown · 54 without an institution code

09Environmental DNA4 detections

Where the DNA of Ficus craterostoma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 20.8–23.6

Seasonal swing summer↔winter6.50 °C

Max temp (day)24.5 °C 24.0–28.0

Min temp (night)19.7 °C 17.8–19.8

Precipitation143 mm/mo 41.9–163

Air humidity59.9 % 58.8–65.5

Moisture balance7.20 mm/mo -104–29.9

Vapour deficit959 Pa 899–1,200

Wind speed3.50 m/s 2.00–4.10

Cloud cover26.8 % 14.3–28.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)