Ficus crassinervia

Desf. ex Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records617

Data sources8

Biological traits11

DNA specimens17

eDNA detections7

Sources8 archives

Databases and archives Ficus crassinervia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility617 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF617 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI17 specimens

01Narrative

Ficus crassinervia là một loài thực vật có hoa trong họ Moraceae. Loài này được Desf. ex Willd. mô tả khoa học đầu tiên năm 1806.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Dispersal typeanimal

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus crassinervia has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes5

GenBank sequences4

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKJ082317.1 ↗409 bpPuerto Rico · 2011

ACGT

GATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAATATGAAGTCAAAGATAGTGATATCTTGGCAGCATTTCGAG …

Ficus crassinervia voucher 0118737145 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type617 records

Wild obs. + sensor17

Museum / vouchered587

Other13

Range

Area of Occupancy AOO1 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 10≤10 km 3>10 km 1

14 georeferenced · 3 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 147≤1 km 2≤10 km 10

159 georeferenced · 428 without coordinates

Open the institutions mapphysical evidence587

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	215
Mexico City, MX	93
Mérida, MX	46
Durango, MX	38
Bronx, US	37
León, NI	21
MEXUlocation not on record	21
Antiguo Cuscatlán, SV	17
Berlin, DE	11
University of Stellenboschlocation not on record	10
Guatemala City, GT	7
Tapachula, MX	6
Area de Conservacion Guanacastelocation not on record	5
Chicago, US	4
Bergen, NO	4
Mexico City, MX	3
BMlocation not on record	3
HEMlocation not on record	3
Fredericksburg, US	2
Universidad de El Salvadorlocation not on record	2
Managua, NI	2
Loja, EC	1
Durham, US	1
MeiseBGlocation not on record	1
Universidad Nacional Autonoma de Nicaragualocation not on record	1
Ulocation not on record	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record	1
CHAPAlocation not on record	1
San José, CR	1
Fort Worth, US	1
Cambridge, US	1
St. Paul, US	1

33 institutions · 562 of 587 vouchered records shown · 23 without an institution code

09Environmental DNA7 detections

Where the DNA of Ficus crassinervia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 25.1–25.7

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.6 °C 27.3–29.6

Min temp (night)23.4 °C 22.2–23.9

Precipitation186 mm/mo 79.2–229

Air humidity67.8 % 64.9–69.2

Moisture balance7.90 mm/mo -92.5–61.2

Vapour deficit1,056 Pa 1,006–1,120

Wind speed3.30 m/s 2.50–4.60

Cloud cover29.9 % 22.2–34.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)