Ficus cordata

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records554

Data sources8

Biological traits26

DNA specimens4

eDNA detections6

Sources8 archives

Databases and archives Ficus cordata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility554 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionNPASS35 compounds

Occurrence & distributionGBIF554 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Ficus glauca là một loài thực vật có hoa trong họ Moraceae. Loài này được Miq. mô tả khoa học đầu tiên năm 1867.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Plant height15 m

⚠ sources differ — GIFT: 15 m · TRY: 10 m

Plant height max7 m

Plant height min1 m

Seed mass0.46 mg

Seed volume0.26 mm³

Seed volume max0.26 mm³

Seed volume min0.26 mm³

Life cycle & reproduction6

Deciduousnessdeciduous

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 850 m

Elevation min105 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density288 mg/cm³

03Chemical composition35 compounds

Compounds documented for Ficus cordata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols11

Lupane triterpenoids6

Gallotannins5

Ursane and Taraxastane triterpenoids3

Gallotannins $ Simple phenolic acids3

Documented compounds35 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	NPASS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bR)-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a,9-diol	present	NPASS
1,6-di-O-Galloylglucose	present	NPASS
2,6-di-O-galloyl-beta-glucose	present	NPASS
2-(3,4-Dihydroxyphenyl)-5,7-Dihydroxy-3-((2S,3R,4S,5R,6R)-3,4,5-Trihydroxy-6-(Hydroxymethyl)Oxan-2-yl)Oxy-Chromen-4-one	present	NPASS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one	present	NPASS
28-Norlup-20(29)-En-3Beta-Hydroxy-17Alpha-Hydroperoxide	present	NPASS
28-Norlup-20(29)-En-3Beta-Hydroxy-17Beta-Hydroperoxide	present	NPASS
3,3'-di-O-Methylellagic acid	present	NPASS
3-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromen-4-one	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus cordata has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN883367.1 ↗592 bpSaudi Arabia · 2016

ACGT

AAACCTGCCCAGCAGAAAGACCCGCGAACACGTTACAACACCCGAGGGGGGAAAGGGGCGCGGGCACGCCCCGGACACTCCTCGCCGGGT …

Ficus cordata subsp. salicifolia voucher Ff112 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8

plant barcodefungal barcode

08Occurrence & distribution

Record type554 records

Wild obs. + sensor407

Museum / vouchered137

Other10

Range

Area of Occupancy AOO1 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 252≤1 km 44≤10 km 9>10 km 10

315 georeferenced · 92 without coordinates

Open the mapobservation + sensor407

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 4

5 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	26
Cape Town, ZA	20
Yaoundé, CM	17
Saint Louis, US	10
Pretoria, ZA	7
MeiseBGlocation not on record	4
Kew, GB	3
Wlocation not on record	3
Moscow State Universitylocation not on record	2
Stockholm, SE	1
Botanic Gardenlocation not on record	1
BRLUlocation not on record	1
Dekalb, US	1
University of Stellenboschlocation not on record	1
Universität Göttingenlocation not on record	1
Uppsala, SE	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
Edinburgh, GB	1

18 institutions · 101 of 137 vouchered records shown · 36 without an institution code

09Environmental DNA6 detections

Where the DNA of Ficus cordata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)