Ficus benguetensis

Merr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records1 968

Data sources9

Biological traits22

DNA specimens20

eDNA detections17

Sources9 archives

Databases and archives Ficus benguetensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 968 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF1 968 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Ficus benguetensis (called 豬母乳 in Taiwan) is a shrub or tree of the family Moraceae living at low altitudes in the Ryu Kyu Islands, Taiwan and in the Philippines but not in Palawan. It lives as an understorey tree in humid forest environment and along streams and rivers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length1 mm

Fruit length max1 mm

Fruit length min1 mm

Leaf length110 mm

Leaf length max130 mm

Leaf length min90 mm

Leaf width50 mm

Leaf width max60 mm

Leaf width min40 mm

Seed volume0.28 mm³

Seed volume max0.28 mm³

Seed volume min0.28 mm³

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment5

Climatewet tropical

Climberself-supporting

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus benguetensis has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes5

GenBank sequences10

eDNA detections17

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJQ773838.1 ↗676 bpChina · 2010

ACGT

CTGCCAGCAGAAGACCCGCGAACACGTTACAACACCCCATGGGGGCGAGGGGCACGAACACGCCCCGGACCCTCCTCGTCGGGTGCGTGT …

Ficus benguetensis voucher 2010232 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Ficus benguetensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×CCDB · book-ipcn66 · CCDB · book-fedorov

CCDB · book-ipcn66 — Pancho 1966

CCDB · book-fedorov — Pancho (C. n. VII. 1966) g

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 968 records

Wild obs. + sensor1 460

Museum / vouchered469

Other39

Range

Area of Occupancy AOO2 888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 692≤1 km 154≤10 km 48>10 km 14

908 georeferenced · 552 without coordinates

Open the mapobservation + sensor1 460

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 467 without coordinates

Open the institutions mapphysical evidence469

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nishihara, JP	244
Odawara, JP	25
Taipei, TW	12
Chiba, JP	6
Kew, GB	6
Taipei, TW	5
Nagano City, JP	5
Nishihara, JP	4
Forestry and Forest Products Research Institutelocation not on record	4
Burlington, US	2
Sendai, JP	2
Sanda, JP	2
South Kensington, GB	2
Kagoshima, JP	1

14 institutions · 320 of 469 vouchered records shown · 136 without an institution code

09Environmental DNA17 detections

Where the DNA of Ficus benguetensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–25.1

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C 9.60–27.5

Min temp (night)3.00 °C 3.00–24.2

Precipitation344 mm/mo 32.7–344

Air humidity64.9 % 47.2–64.9

Moisture balance263 mm/mo -123–263

Vapour deficit428 Pa 428–1,449

Wind speed2.90 m/s 2.90–5.30

Cloud cover44.6 % 29.9–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ficus benguetensis

At a glance

Sources9 archives

Size & morphology12

Life cycle & reproduction3

Habitat & environment5

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 968 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 968 records