Ficus albipila

(Miq.) King · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Ficus

At a glance

Occurrence records246

Data sources7

Biological traits22

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Ficus albipila's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility246 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF246 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Ficus albipila atau yang sering disebut sebagai kayu lian di Indonesia, adalah spesies tumbuhan berbentuk pohon dari famili Moraceae. Tumbuhan yang dikenal dengan nama pohon lelas, leles, atau leses (Jawa) ini berasal dari bioma beriklim tropis basah, dengan rentang sebaran mulai dari India selatan hingga Queensland utara dan timur. Nama ilmiahnya pertama kali dipublikasikan oleh botanis Friedrich Anton Wilhelm Miquel pada 1888.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length16 mm

Fruit width16 mm

Leaf length170 mm

Leaf width90 mm

Petiole length5 cm

Plant height45 m

Seed length1 mm

Seed mass0.284 mg

Seed width1 mm

Life cycle & reproduction3

Life formtree

Life spanperennial

Sex typemonoecious

Habitat & environment9

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typesyconium

Growth formtree

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ficus albipila has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF165375.1 ↗701 bp

ACGT

TTTCCGTAGGTGAAGCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAGAGACCCGCGAACACGTTACAACACTCGAGGGGGGCGAG …

Ficus albipila 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type246 records

Wild obs. + sensor41

Museum / vouchered154

Other51

Origin

Native7

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 12≤1 km 4>10 km 19

35 georeferenced · 6 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 13≤1 km 20≤10 km 56>10 km 10

99 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	43
Brisbane, AU	33
Canberra, AU	16
Mount Annan, AU	6
Museo Entomologico de Leonlocation not on record	4
Palmerston, AU	4
MSB-3349location not on record	1
ASUlocation not on record	1
BISHlocation not on record	1
Australian Tropical Herbariumlocation not on record	1
Honolulu, US	1

11 institutions · 111 of 154 vouchered records shown · 43 without an institution code

09Environmental DNA2 detections

Where the DNA of Ficus albipila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 23.2–23.2

Seasonal swing summer↔winter7.30 °C

Max temp (day)26.5 °C

Min temp (night)19.8 °C

Precipitation360 mm/mo

Air humidity69.6 %

Moisture balance212 mm/mo

Vapour deficit861 Pa

Wind speed2.70 m/s

Cloud cover63.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)