Festuca violacea

Ser. ex Gaudin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records23 429

Data sources9

Biological traits22

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Festuca violacea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 429 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF23 429 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Festuca violacea, la Fétuque violacée, est une espèce de plantes herbacées de la famille des Poaceae et du genre des fétuques.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology6

Plant height0.238 m

Plant height max0.5 m

Plant height min0.3 m

Seed mass1.47 mg

Seed mass max1.47 mg

Seed mass min1.47 mg

Life cycle & reproduction6

Dispersal typewind

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: graminoid

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)10.78 mm²/mg

Other traits1

Diaspore typefruit

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca violacea has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSEF584979.1 ↗580 bpSwitzerland

ACGT

TCGTGACCCTAACCAAAACAGACCGCGCACGGTCATCCTGCCTGCCGGGCGGCGACACCGTTCGTCGCCCGGCCAAAGTCCTCGAAAACC …

Festuca violacea internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca violacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · fl-europaea · CCDB · book-ipcn67-71

CCDB · fl-europaea — Zickler, 1968

CCDB · book-ipcn67-71 — POGHOSIAN, A.J., S.G. NARINIAN, & V.E. VOSKANIAN. 1971. Data on the caryogeographical study of flora of the Aragatz massif. Biol. Zurn. Armenii 24: 11: 37-43.

n 73×CCDB · ita-fl · CCDB · book-ipcn67-71

CCDB · ita-fl — TOMBAL P. - 1968. Orophytes alpines et subalpines (Monocotyldones).. Caryosystematique et Cytogenetique , 2: 9/12/2000.

CCDB · book-ipcn67-71 — TOMBAL, P. 1968. Orphytes alpines et subalpines. (Monocotyledones). Inf. Ann. Caryosyst. et Cytogenet. 2: 9-12.

CCDB · book-ipcn67-71 — ZICKLER, D. 1968. Orophytes endemiques ou rares. Inf. Ann. Caryosyst. et Cytogenet. 2: 1-4.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type23 429 records

Wild obs. + sensor23 185

Museum / vouchered244

Range

Area of Occupancy AOO6 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 3 565≤1 km 217≤10 km 14 295>10 km 1 164

19 241 georeferenced · 3 944 without coordinates

Open the mapobservation + sensor23 185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 3≤1 km 7≤10 km 73>10 km 2

85 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence244

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	53
Zürich, CH	53
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	24
LDlocation not on record	15
Bern, CH	13
Barcelona, ES	12
Glarus, CH	10
Wlocation not on record	6
Institut und Museum fuer Geologie und Palaeontologielocation not on record	5
Sion, CH	5
Dresden, DE	4
Uniwersytet Jagiellońskilocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
Dhaka, BD	2
Musée des Confluenceslocation not on record	2
GJOlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Frankfurt am Main	2
Fribourg, CH	1
BClocation not on record	1
CJBGlocation not on record	1
Auckland, NZ	1
Görlitz, DE	1
BIO-UNIPIlocation not on record	1
Bourges, FR	1
BDBClocation not on record	1
BRNUlocation not on record	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Provincia di Livornolocation not on record	1
Oskarshamn, SE	1
Uniwersytet Warszawskilocation not on record	1
GZUlocation not on record	1

32 institutions · 232 of 244 vouchered records shown · 12 without an institution code

09Environmental DNA1 detections

Where the DNA of Festuca violacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Festuca violacea

At a glance

Sources9 archives

Size & morphology6

Life cycle & reproduction6

Diet & foraging1

Habitat & environment6

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type23 429 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type23 429 records