Festuca valesiaca
Schleich. ex Gaudin · speciesAt a glance
Occurrence records21 980
Data sources10
Biological traits38
DNA specimens5
eDNA detections4
Sources10 archives
Databases and archives Festuca valesiaca's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility21 980 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics5 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Occurrence & distributionGBIF21 980 records
Environmental DNA1 datasets · 1 countries4 detections
DNA & barcodingBOLD · NCBI5 specimens
Genome at a glanceCCDB · GoaT2.2 Gbp
01Narrative
La festuca valesiaca, detta anche festuca del Vallese è una specie di pianta della famiglia delle Poacee.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology8
Plant height0.158 m
⚠ sources differ — GIFT: 0.158 m · LEDA: 0.16 m · TRY: 0.11 m
Plant height generative0.228 m
Plant height max0.75 m
Plant height min0.2 m
Seed length3.87 mm
Seed mass0.45 mg
⚠ sources differ — TRY: 0.45 mg · LEDA: 0.86 mg · GIFT: 0.67 mg
Seed mass max0.48 mg
Seed mass min0.48 mg
Life cycle & reproduction11
Deciduousnessaestival
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endJul
Flowering startMay
Life formperennial
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 700 m
Elevation mean2 350 m
Elevation min1 000 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio33.54 g/g
Leaf c463 mg/g
Leaf dry-matter content (LDMC)406 mg/g
Leaf n12.97 mg/g
Leaf p1.66 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)19.43 mm²/mg
Other traits1
Diaspore typefruit with appendage
05DNA & barcoding5 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca valesiaca has left across the world's sequence archives.
At a glance
DNA specimens5
Marker genes5
GenBank sequences10
eDNA detections4
Countries3
The DNA barcodea real sequence read deposited for this species
TCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCTGCCTGCCGGGCGGCGGCACCGTCTGTCGCCCAGCCAAAGTCCTCGAAACT …
Festuca valesiaca isolate Fb573 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL2★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Festuca valesiaca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 226 417 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Festuca valesiaca2.23 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–702n range14median14mode39records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1433×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iapt +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Váchová M., 1987: Karyological study of the Slovak flora XXI. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 34: 27-32.
CCDB · slov-fl — Baksay L., 1958: The chromosome numbers of ponto-mediterranean plant species. - Ann. Hist.-Nat. Mus. Natl. Hung. 50 (Series nova 9): 121-125.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · fl-europaea — Baksay, 1958
CCDB · poland — Mizianty M. and Pawlus M. 1982. Chromosome numbers of some Polish species from the genus Festuca group Ovina (part I). Fragm. Flor. Geobot. 28, 363-369.
CCDB · mediterranean
CCDB · ipcn-api-dl — Pils, G. 1984. Systematik, Karyologie und Verbreitung der Festuca valesiaca - Gruppe (Poaceae) in Osterreich und Súdtirol. Phyton (Horn) 24: 35–77.
CCDB · ipcn-api-dl — Alexeev, E. B., A. P. Sokolovskaya & N. S. Probatova. 1988. Taxonomy, distribution and chromosome numbers of fescues (Festuca L., Poaceae) in the flora of the USSR. 3. The section Festuca: F. tschujensis--F. beckeri. Bjull. Moskovsk. Obač. Isp. Prir., Otd. Biol. 93: 90–99.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1980. A karyotaxonomic study of the grasses of the Altai Mts. Bot. Zhurn. 65 (4): 509–520.
CCDB · ipcn-api-dl — Sokolovskaya, A. P. & N. S. Probatova. 1979. Chromosome numbers of some grasses (Poaceae) in the U.S.S.R. flora. III. Bot. Zhurn. 64 (9): 1245–1258.
CCDB · ipcn-api-dl — Májovský, J. & M. Váchová. 1986. Karyological study of the Slovak flora XIII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 63–67.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Zakharyeva, O. I. 1985. Chromosome numbers of some flowering plants from the Caucasus and Middle Asia. Bot. Zhurn. SSSR 70(12): 1699–1701. (In Russian).
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaja & E. G. Rudyka. 1991. Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1174–1178.
CCDB · ipcn-api-dl — Váchová, M. 1987. Karyological study of the Slovak flora XXI. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 34: 27–32.
CCDB · ipcn-api-dl — Nazarova, E. & A. Goukasian. 1995. Mediterranean chromosome number reports 5 (528--542). Fl. Medit. 5: 340–345.
CCDB · ipcn-api-dl — Daniela, I. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 13–14.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Schreiner, R. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Ausrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Tracey, R. H. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Gadnidze, R. I., T. N. Gviniashvili, I. M. Danelia & M. V. Churadze. 1998. Chromosome numbers of the species of the Georgian flora. Bot. Žhurn. (Moscow & Leningrad) 83(10): 143–147.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Smarda. 2005. Ploidy level variability of some central European fescues (Festuca subg.) (Festuca, Poaceae). Biologia (Bratislava) 60(1): 25–36.
CCDB · book-ipcn72 — CHANDRASEKHARAN, P . E.J. LEWIS, & M. BORRILL. 1972. Studies in Festuca. II Fertility relationships between species and sections Bovinae and Scariosae, and their affinities with Lolium. Genetica 43: 375-386. ---
CCDB · book-ipcn73-74 — MALIK, C.P., & R.C. TRIPATHI. 1973. Cytological studies in the genus Festuca. Chromosome Inf. Serv. 15: 25-27.
CCDB · book-indian_vol2 — BakSay, L. 1958; Alekseev, E.B. 1974
CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
2n 283×CCDB · fl-europaea · CCDB · book-indian_vol2 · CCDB · book-atlas-flowering-plants
CCDB · fl-europaea — Felftfldy, 1947b
CCDB · book-indian_vol2 — FelfOidy, L.J.M. 1947b ; Mehra, P.N. & Remanandan, P. 1973a; Mehra, P.N. & Sharma, M.L. 1977
CCDB · book-atlas-flowering-plants — Felfoldy 1947b
2n 422×CCDB · poland · CCDB · book-indian_vol2
CCDB · poland — Mizianty M. and Pawlus M. 1982. Chromosome numbers of some Polish species from the genus Festuca group Ovina (part I). Fragm. Flor. Geobot. 28, 363-369.
CCDB · book-indian_vol2 — Gagnieu, A. & Braun, A. 1959 ; Mehra, P .N. & Sunder, S. 1969 ; Chopanov, P. & Yurtsev, V.N. 1973
2n 701×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Mehra, P.N. & Sunder, S. 1969
n 143×CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 · CCDB · iapt
CCDB · book-ipcn75-78 — Mehra & Sharma 1977
CCDB · book-ipcn73-74 — MEHRA, P.N., & P. REMANANDAN. 1973. Cytological investigations on W.l Himalayan Pooideae. Cytologia 38: 237-258.
CCDB · iapt — IAPT/IOPB Chromosome Data 33
n 72×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Schreiner, R. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Ausrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Tracey, R. H. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
n 281×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 31
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type21 980 records
Wild obs. + sensor18 154
Museum / vouchered2 932
Cultivated / captive18
Other876
Origin
Native4
Introduced23
Range
Area of Occupancy AOO22 748 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy54% within 1 km
≤100 m 3 587≤1 km 3 311≤10 km 5 397>10 km 389
12 684 georeferenced · 5 470 without coordinates
Open the mapobservation + sensor18 154
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy67% within 1 km
≤100 m 603≤1 km 359≤10 km 432>10 km 46
1 440 georeferenced · 1 492 without coordinates
Open the institutions mapphysical evidence2 932
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 1≤1 km 1
2 georeferenced · 16 without coordinates
Open the mapnot free-living18
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions38 of 84 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 1 040 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 156 |
| Zürich, CH | 144 |
| BRNUlocation not on record | 124 |
| Zürich, CH | 92 |
| Wlocation not on record | 74 |
| Berlin, DE | 41 |
| Beijing, CN | 34 |
| PRClocation not on record | 20 |
| WTUlocation not on record | 19 |
| Irkutsk State Universitylocation not on record | 17 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 17 |
| GJOlocation not on record | 16 |
| Corvallis, US | 15 |
| Samara National Research Universitylocation not on record | 15 |
| BClocation not on record | 14 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 14 |
| Provincia di Livornolocation not on record | 12 |
| University of Stellenboschlocation not on record | 11 |
| LDlocation not on record | 11 |
| Uniwersytet Wrocławskilocation not on record | 10 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| Uniwersytet Jagiellońskilocation not on record | 10 |
| Urumqi, CN | 10 |
| Bern, CH | 10 |
| Dresden, DE | 10 |
| Xining, CN | 9 |
| Logan, US | 9 |
| Kew, GB | 9 |
| Salzburg, AT | 8 |
| GMBAlocation not on record | 8 |
| SZUlocation not on record | 8 |
| BDBClocation not on record | 8 |
| Sion, CH | 8 |
| BGBMlocation not on record | 7 |
| Burlington, US | 7 |
| Frankfurt am Main | 7 |
| Saint Louis, US | 7 |
| Tula State Universitylocation not on record | 6 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 6 |
| GZUlocation not on record | 6 |
| BFLlocation not on record | 5 |
| Guangzhou, CN | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Görlitz, DE | 4 |
| BG-NMNHSlocation not on record | 4 |
| Nanjing, CN | 4 |
| Moscow, US | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Durham, US | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| ROM007location not on record | 3 |
| Edinburgh, GB | 3 |
| Boise, US | 3 |
| Oskarshamn, SE | 3 |
| HUN003location not on record | 3 |
| Bend, US | 2 |
| CZE082location not on record | 2 |
| Regensburgische Botanische Gesellschaftlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Wuzhou, CN | 2 |
| MeiseBGlocation not on record | 2 |
| Cheney, US | 2 |
| Pullman, US | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 2 |
| nlocation not on record | 1 |
| College Park, US | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Karlsruhe, DE | 1 |
| GBR016location not on record | 1 |
| Fribourg, CH | 1 |
| Auckland, NZ | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Bronx, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Portland, US | 1 |
| Barcelona, ES | 1 |
| Ashland, US | 1 |
| ER-Gaucklocation not on record | 1 |
| Caldwell, US | 1 |
| Uppsala, SE | 1 |
84 institutions · 2 151 of 2 932 vouchered records shown · 779 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA4 detections
Where the DNA of Festuca valesiaca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map1 country0
disturbed roadside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median20.2 °C 20.2–20.2
Seasonal swing summer↔winter22.8 °C
Max temp (day)26.0 °C
Min temp (night)11.8 °C
Precipitation31.6 mm/mo
Air humidity50.1 %
Moisture balance-131 mm/mo
Vapour deficit1,177 Pa
Wind speed2.80 m/s
Cloud cover22.7 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.