Festuca vaginata

Waldst. & Kit. ex Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records281

Data sources9

Biological traits19

DNA specimens1

eDNA detections0

Sources9 archives

Databases and archives Festuca vaginata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility281 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF281 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT2.4 Gbp

01Narrative

Kostrzewa pochwiasta – gatunek rośliny z rodziny wiechlinowatych. Występuje w środkowej, wschodniej i południowo-wschodniej Europie. W Polsce jest gatunkiem rzadkim; rośnie na rozproszonych stanowiskach w środkowej i zachodniej części kraju.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.783 m

Plant height max0.6 m

Plant height min0.25 m

Seed mass1.04 mg

Life cycle & reproduction5

Flowering endJun

Flowering startDec

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: graminoid

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)413 mg/g

Leaf n17.03 mg/g

Leaf p1.4 mg/g

Specific leaf area (SLA)17.18 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca vaginata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP335025.1 ↗596 bpCroatia · 2021

ACGT

TCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCTGCCTGCCGGGCGGCGGCACCGTCTGTCGCCCAGCCAAAGTCCTCGAAACT …

Festuca vaginata isolate Fb619 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Festuca vaginata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 396 589 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Festuca vaginata2.4 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome records14–562n range14median14mode15records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1414×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · ipcn-api-dl +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Schwarzová T., 1968: Beitrag zur Lösung taxonomischer Probleme der Festuca vaginata W. K. und Festuca psammophilla Hack. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 14 [1967]: 381-417.

CCDB · ipcn-api-dl — Schreiner, R. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Ausrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · ipcn-api-dl — Tracey, R. H. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · ipcn-api-dl — Smarda. 2005. Ploidy level variability of some central European fescues (Festuca subg.) (Festuca, Poaceae). Biologia (Bratislava) 60(1): 25–36.

CCDB · ipcn-api-dl — `marda, P. & K. Kočí. 2003. Chromosome number variability in Central European members of the Festuca ovina and F. pallens groups (sect. Festuca). Folia Geobot. 38(1): 65–95.

CCDB · book-ipcn67-71 — SCHWARZOVA, T. 1967. Beitrag zur LBsung taxonomischer Probleme der Festuca vaginata W.K. und Festuca psammophilla Hack. Acta Fae. Rerum Nat. Univ. Comenianae. Bot. 14: 381-412.

CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.

CCDB · Cave1962 — Baksay 1956

2n 561×CCDB · brit-fl

CCDB · brit-fl — Al-Bermani, A.-K.K.A. (1991)

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type281 records

Wild obs. + sensor206

Museum / vouchered50

Other25

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 15≤1 km 1≤10 km 2>10 km 1

19 georeferenced · 187 without coordinates

Open the mapobservation + sensor206

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 5≤10 km 8

13 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Dresden, DE	8
Wlocation not on record	5
Oskarshamn, SE	4
Canadian Department of Agriculturelocation not on record	4
Uniwersytet Jagiellońskilocation not on record	3
HUN003location not on record	3
BRNUlocation not on record	3
Provincia di Livornolocation not on record	3
LDlocation not on record	3
Salzburg, AT	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
College Park, US	1
Hungarian Natural History Museumlocation not on record	1
Barcelona, ES	1
Turku, FI	1
Uppsala, SE	1
GBR016location not on record	1
MSB-3797location not on record	1

19 institutions · 49 of 50 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)