Festuca subuliflora

Scribn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records347

Data sources11

Biological traits11

DNA specimens16

eDNA detections2

Sources11 archives

Databases and archives Festuca subuliflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility347 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF347 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI16 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Festuca subuliflora is a species of grass known by the common name crinkleawn fescue. It is native to western North America from British Columbia to California where it is most abundant in the moist forests of the coastal mountains.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca subuliflora has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes9

GenBank sequences8

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV126374.1 ↗708 bpUSA · 1949

ACGT

TAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGC …

Festuca subuliflora voucher Baker 156 & Ruhle (US) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Festuca subuliflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · brit-fl · CCDB · book-atlas-flowering-plants

CCDB · brit-fl — Maude, P.F. New Phytol. 39: 17-32 (1940)

CCDB · book-atlas-flowering-plants — Maude 1940

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type347 records

Wild obs. + sensor31

Museum / vouchered316

Range

Area of Occupancy AOO940 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 20≤1 km 6>10 km 1

27 georeferenced · 4 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 14≤1 km 67≤10 km 51>10 km 4

136 georeferenced · 180 without coordinates

Open the institutions mapphysical evidence316

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Angwin, US	41
Vancouver, CA	32
Corvallis, US	29
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	29
Pullman, US	27
Moscow, US	24
WTUlocation not on record	20
Davis, US	17
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	10
Arcata, US	7
Claremont, US	7
Santa Cruz, US	5
CASlocation not on record	4
Victoria, CA	4
San Luis Obispo, US	4
University of Alberta Museumslocation not on record	4
DOI/NPS, San Juan Island National Historical Parklocation not on record	4
San Jose, US	3
Portland, US	3
Bureau of Land Management, Medford District Officelocation not on record	3
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	2
Saint Louis, US	2
Bend, US	2
Ashland, US	2
GB	2
Logan, US	1
University of Stellenboschlocation not on record	1
San Diego, US	1
Boise, US	1
STNFlocation not on record	1
Portland, US	1
Bloomington, US	1
Cheney, US	1
Bronx, US	1
South Kensington, GB	1

35 institutions · 297 of 316 vouchered records shown · 19 without an institution code

09Environmental DNA2 detections

Where the DNA of Festuca subuliflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 13.9–15.5

Seasonal swing summer↔winter13.1 °C

Max temp (day)18.7 °C 17.7–19.6

Min temp (night)11.4 °C 10.6–12.1

Precipitation37.0 mm/mo 36.5–37.4

Air humidity60.1 % 59.7–60.5

Moisture balance-92.5 mm/mo -96.3–-88.7

Vapour deficit669 Pa 639–700

Wind speed2.60 m/s 2.20–3.00

Cloud cover38.0 % 37.8–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)